GenePrediction:GLEAN_404 Details

Name: GLEAN_404
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1573959..1575106 (+ strand)
Length: 1148
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1573959..1574190 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_167:1574247..1575106 (+ strand)
Length: 860
>GLEAN_404 class=GenePrediction position=GCSC_167:1573959..1575106 (+ strand)
ATGCAGCTGCTAGGACCGACTACTGTCAGCACCTCGCCACGTCTGCCGCCTCTGATGCGTCGCACTCGCATCGTGTGTAT
ATCGGACACGCACAACAGCAGGGTGAAGCTTCCCAAGGGAGACGTTCTGATCCACGCGGGCGACTTGACGAACCAGGGCA
GCTATTCTGAGATCACGCGGGCTGTTGCCTGGCTCGAAGAGGCACCTTTCGAATGCAAGATTGTCGTTGCAGGTGAGCAA
GTGATGCATCTATGGAGACGACCGGCTGCTGACGTAGAGCCGAAAAAGGAAATCATGACATCACCTTGGACCGGGCGTTT
TACGCACAACACAACAGGCGTTTTCACAACCAGTCGCCACAGCCAACAGACGAGTGTCTGGCCCTCCTGACAGCAAGCCC
CAGCATCACGTACCTGAGCCACGGATCCGCCTCGGTTTTCCTGAAGGCTGCAGGGGGGCCACACACACAGTTCACCGTTT
TTGGCTCTCCATACAGCCCTCGGGACGGTACGAGTTCCTGGGCCTTCCAATACGACCGCATGGGCACTAGCATGTCCGGA
TCATCGCTCTCTTTCCCGGCTGGGCCCGGCACTGTCCCGTATGCGGATGATTCGGCTGCAGCTGTAGGGGTGTGGTCTGC
CATTCCTGCTACTGCCGACATTGTGGTCACGCACACGCCTCCGTTCGGACACTGTGACTGGTCTACAGCACGGGACCGGG
CGATGGGCTGCGAGGGCCTCCGTCGGGCGCTATGGCAGACACGGCCGCGGTTGGTCGTATGCGGACACGTCCACGAAGGG
CGAGGCGTCGAGCGGGTTCGGTGGTCATCGGAGGGCGAGCAGGGATCAGCGGACGGGGCCGGTGGCGAAGTGGCGGTCGA
CAGCTGGCAGGATCCAGGCAGAGACGGTGGGAAGCTATCTATCGTCGACCTGACGACACGTGGAACCAGGCACAGCCTCG
ACGACGGAACAGCTGGGCAGGCAAGCGAGGGGAGATGGACACAGGCCGGGGATGGAAAGGGCCGACGAGAGAGCTGCATC
GTGAACTGTGCGATCACGGCGACTAACTACCCGCACGTTGGAGGCAAGCGATTGAACAAGCCGGTTGTAGTGGACCTCGA
CTTGCCGGTGTGGGAGGAGCCGGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62