GenePrediction:GLEAN_4053 Details

Name: GLEAN_4053
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2482740..2485413 (+ strand)
Length: 2674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2482740..2482779 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_113:2482842..2482984 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_113:2483062..2485413 (+ strand)
Length: 2352
>GLEAN_4053 class=GenePrediction position=GCSC_113:2482740..2485413 (+ strand)
ATGGAGTCCATCTCCCGCATAACCAGTCTGCTCGAGAGCGGTATGTAAATTCCGTCGAAGAAGGCGAAATATGGCACCCA
TGCTGACGAACGGCGATGACAGCGAGAGAACTCACGCTCGATGCGTCCTCGGCGGCCCGCGGGCTTCGCAGCAGCCCCCG
ACCGCTCGACAGCCGACAGATCAAGAAGCTGCTCGACAGCCGCACCGAGCGGGAGGTCCTCGACGGACTGCGGCGGGTGA
CATCTGTATGTGGTTCTGGAGAGCTTCTGGGGGCTTCTGGTGTCTTTTGGTGGGCTCCTTGTGCTGATACGATTTTCAAC
AGATGATGTACGGCGGCCAGAAGACGCTGCCCTTCTTCTCGTCCGTGGTCAAGAACGTGGCGTCGCCGAACCTCGAGATC
AAGAAGCTCGTCTACATCTATGTGGTGCATCATGCCGAACAAGAACCCGACATGGCCCTTCTCTCCATCAACACGATCCA
GAAGTCGCTGTCAGACGCGAATCCGCAAGTTCGCGCTCTCGCCCTGCGAACGATGTCGGGCATCCGCGTACCGGTCATTA
GCCAGATCGTCTCGCTAGCCATCAAGAAGGGCACCGGCGACATGAGCCCATACGTGCGCCGTGCCGCGGCCATGGCCATC
CCCAAGTGCTACCGTCTCGACCCCGGTCAGCTGCCGCAGCTGCTCGAGTATTTGGCCGTGCTGCTGGGAGACAAGCAGTA
CTACGTGGCCGGGGCGGCCGTCACGGCCTTTATGGAAGTGTGTCCTGATCGGGTGGACCTGATCCATAAGAACTACCGCT
CGCTGGTCAAGAAGATTGTCGACATGGACGAATGGAGCCAGCTGGCCACGCTGCGACTGATGACCATCTACGTGCGAAAG
TGCTTTCCGCGGCGGACGAAGCTCGTGGCTGGAAAGAGCAATGGAAACGGCACGTCGACAGCAGCGACAGCAGCAACAAG
GCCCAGCCTGGGCGATTTTTACGGAGAGACGCAAGACACGAATACGAAGACGGAGAACAGCAGCAGCAGCGACGGTGATG
GCGAGAAACAGACGGTTGTGGTGCTGGATCCGGATCTCTCGTTGCTGCTGGACGCGATCAAGCCGCTGCTGCAGAGTCGC
AACTCGGCCGTGGTGGTGGCAGTGGCACGGTGCTACGTCAGCGTGGGCACGACCGAGTACGTGCGGACGGCCGTTGGACC
GCTGGTGGCCCTGCTGCGAGGACCGCAAGACATCCAGCAGGTAGCTCTGTACAACATCGCGTCGGTGTGCCTGGACTACG
CGAACGACTTTGTGCGGTACGCATCGCACTTTCTAGTGCGGGCGAGCGACCCGCCAGCGGTATATGAGCTCAAGATCGAG
GTGCTGGCGCTCATCTTCCCCCACGGCTCACGGGCGGTCAAGTCGCTGATCCTGCACGAGCTGGAGCACTTTGCACGCGG
GACGGACAAGACGCTGGTGCGCGAAGCTGTACGAGCGATTGGACGGTGCGCACAGGCGGACCCGGACCCATCGACATCGG
GGCGCTGTCTGCGTCTGCTGCTGGGGCAGATCACGAGTCTGGACGGCACTCTGGCGGCAGAGAGCCTGACGGTGATCCGA
CATCTGATCCAGCAAGACCCTCCCGGACACGCGGCGACGGTGGTGCGACTGGCACGGAATCTGGACGTGGCCACAGACCC
GCAGGCGCGCGCGACGATCATCTGGCTGGTCGGCGAATTTTCGGGGCTGAATGGCGAGGACAACATCGCGGCGGACGTGC
TGCGGATCCTGCTCAAGGACTTTGCCGGCGAGTCGGAGGCGGCCAAGCGGCAGATCGTGCTGCTGGGAGCCAAGGTGTAC
CTGCACCACGTCAACCGGACGGCCAAGACAGAGCCGGAAGACAATCAGCAGCAGCAGCAGCAGCAGCAGCAGCACCCGGT
TGTGCGGCTGTGGGACTATGTGCAGCTGCTGGCGCGTTACGACACGTCGTATGACCTGCGCGACCGTACACGACTGTACC
GGGCGCTGCTGGCGGTACCACAGCTGGCGACGTTGATGCTGCTGGCGCCGAAGCCGGTGCCACACGCGCCCAGTCCGGCG
GAGCTGCGCAGGGGCTTCACGCTGGGATCGGCAGCGCTGGTGCTGGGCGGTGGCGATGCGGGTGCAGGTGTCGGTGTGTA
CGGGCTCGCAGGCTACGAGTCGCTGCCGGTCTGGGTGCAGGAGGGTGAGCAGCCGGATGGGCGGCTGCGTGACAGCGACG
ACGACATGCAGGGCCGCGAGTACGAGAGCAGACGGGGAGCGACGAGGCCAGCAGCAGACAGCCTGGACAAGGCAGCAGCG
CAAGGCCACCGAGTAGGAGGAGCAGCAGGAGCGGCAGGAGCAGCAGGAGCAGCATCCAACGGATCACGTGGACAGGTTGG
AGGAAAGACACTGGACGACTGGCTCGCAGAGGAAGAGACGAGCGATGAGGAGACAGGCGACGAGGATGAAGAGGAGGAGA
CGAGCGAAGAAGGAGATGACGAAGGAAACGACGACGAAGGAGACGACGACGGAGACAGCGACGAAGAGGAAGAAAGCGGC
GGAGAGGGGAAAGAGAGTGAAGAGGGAGAAGGAGGCGACAACAGCGAAGACGGAGCCGGTTCTGACGACAGCGAAAACGG
AGAGGAAAACGCGCCGCTTGTCAAGACCAGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62