GenePrediction:GLEAN_4055 Details

Name: GLEAN_4055
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2490850..2492701 (+ strand)
Length: 1852
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2490850..2490916 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:2490995..2492378 (+ strand)
Length: 1384
Type: CDS
Source: GLEAN
Position: GCSC_113:2492488..2492701 (+ strand)
Length: 214
>GLEAN_4055 class=GenePrediction position=GCSC_113:2490850..2492701 (+ strand)
ATGGCCTCGTGGAATTCACCATCTGTGGCCGGTGCCCAACCTCATAGGTATGCGCAATATTCTGCCGGTAAGCATCAAAT
TCCACCGTCATCCGACAAAACGATCAGCGACAAGACTTGCGTGCTAACCTGCCCTCTCTCGCCAGCACCCGCATACACAC
CAGTGCAGGTTCGACAGACATTTGCTGCACCCTCGTCCTACACCCAGCCATCCTCGTACTCAAACTCTACCGTGACATAT
TCCTCTCAAGCATCGCCATACGGCCTTGCACACCTAGCAGCTAATCCATCTCCGCCACCCCCGGCCCCATCGGACGAGGC
AGCAAAAAAGAAGATTGACTGGCCCGTGTCTGTCCGTAACTATGTCCAGCGATCCTTTCTCCCCTCCAACATGGACCCGA
CAGTCTCCCGCACAGATATGGAGAGCAAGCTGAAGGAAACCATATCGCAAGCCAATGAAACCGGTGTGATGTACACCATC
AACTGGGAGAACATGCCGCTGCCACAACAGTTGGTCCGGGAAGAACGCGATCGCACCCTTACAGCACAGCTACAGTTAGC
CGCCGCCGCCGCCGCCTCCTCGCACGCATCCTACCGGGACCCTCGCCAACAGCCGGGCGTCTGGTCCAGCAGCAGCATCG
CGCCCGTCGTAGCGTCTAAGAAGCGCAAGTCGATCGACCCACAGGATGATGGCAGCAGCGGCAGCAGCTCTTCCACCTCA
CTTCCCTGGAGAAAAGCGGCCGGTCCGCTGGCCGACCGCATCGGCCGTCACGACAAAGCCGACGACAGCCACGCCCACGT
CCACAGCAGCCAACTGGACGAGTCGTCCAAGAGTAAGTTTCAGAAGCAGCTCGAGAAGCGCCAACGCCGCTTTGACGGGG
GCTACAAGGCGAAGGCCAGGTCGGTCACCCCGGAGCCCGACGCGGCTGCCGGCCCCGTCGTCGGCACGTCCCAGACCCTG
GAGAAGCGCTATCTGCGACTGACGGCTGCCCCCAAGCCGGAGTTTGTGCGGCCCGAGCACATCCTGCGCCAGTCGCTGGA
GCTGCTGAAGAAGAAATGGCGGATGGAGGGAAACTACTCTTACATTTGCGACCAGTTCAAGTCTATGCGGCAGGATCTCA
CGGTGCAGCACATCCGCAACGATTTCACCGTCGCTGTCTACGAGATCCACGCCCGCATCGCACTGGAAAAGGGGGATTTG
GGTGAGTATAACCAGTGCCAGACGCAGCTGAAAGCCCTCTATCAGCTCGGTCTCAAAGGCAATCCGGTGGAGTTCAAGGC
GTATCGCATCTTGTACTTTATCCATACTGCCAACCGTTCGGCACTGAACGACGCCATTAAGGATCTAACCACAGCAGAGA
AGGGAGAGCTCCCCATCCAGCATGCTCTTAACGTGCGCTCATCGCTCGCCCTGGGCAACTTTCACCGTTTCTTCCAGCTT
TACCTCAACACCCCAAATATGGGCGCCTATCTGATGGACATGTTTGTTGGTCGCGAGCGCCTAGCAGCATTGTGCAACAT
CTGCCGAGCGTAAGATACCCTCTCGCTCCCTCTCTATTCTTCTGCCCCCCTCCATTTCTCTGCCCCCCTCCATTTCTCTG
CCCCCCTCCAAGCTATCCGTCACTAATTCTCCCCTCAGATACAAACCCGATGTCCATCTCCGTTTCATCACCGAAGAGCT
AGGCTTCGAGTCCGACGCCGATGCTGCCCAGTTCATCATCGACTATGGCGGCCAAGACCTCCTGGAAGAGCACGAAGATC
ACATCGTGTTTCTCTCAGGGGCGGCAGGCCAGAGATTTGAGGCTGCCCGAAAAGCAGCTTTCAGCAAAGTCGATATCAAA
GGTCAACTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62