GenePrediction:GLEAN_4056 Details

Name: GLEAN_4056
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2497911..2499954 (+ strand)
Length: 2044
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2497911..2497916 (+ strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_113:2497981..2498073 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_113:2498135..2498905 (+ strand)
Length: 771
Type: CDS
Source: GLEAN
Position: GCSC_113:2499130..2499954 (+ strand)
Length: 825
>GLEAN_4056 class=GenePrediction position=GCSC_113:2497911..2499954 (+ strand)
ATGAAGGTGTGTGGCTCTTCCCCTCCATCAACCCCTACCATCGTTTGGGGTAAAATTAACCTCCACACAGGCTCTCCGAA
GGTCAATAAAGGGAGAGAAAGAGGTCAAATCCCACGCTTCCATAACCCCCAAGTCCGCCGTCGCTATTGTTCCCCCTAAG
AAGGTTTGTCTCTCTCTCGGCACCTGCTACTCGTCCCGGCCCACCTTACTAACTGGAGCCCAAGGTCATCCGTGCGCTTT
ACGATTACGAGGCCCAATCATCCCAAGAATTGAGCTTTTCTCGTGGTGACTTTTTTCATGTTATTGGCCGCGAAAACGAC
CAGGACTGGTACGAAGCTTGCAATCCTGCTCTGCCCGACGCTCGTGGCCTAGTCCCTGTGGATTTTTTCCAGGCTCTTGG
CCGTACCGAGCGAGACAGCGCCCAGTCCGACCGTTCCGGCGCTTCATCGGTGAAAAATCCCGACCACGACTCGGGCTACG
CCGAAGCATCCTCACCCAGCGCCATGACGAACGCAATTGCCCCTACGTCGGCTGGGGCCCAGCGCGATTCTAGGTTGGGT
GGCAAGGGAAACGGCGTCATGGTTTATGGCGTCGTCATGTACGATTTCCAGGCAGAACGAGCAGACGAACTCGAAGCCAA
AGCTGGCGAAGCCATCATTGTCATCGCCCAGTCGAATCCCGAATGGTTCGTCGCAAAGCCCATCGGCCGTCTGGGCGGTC
CTGGTCTCATCCCTGTGTCGTTTGTCGAAATCCGGGATATGACTTCGAACACACCAGTTCCCGACCCTCAAGAGGCCGTT
CGCCAAGCTGGCATCCCCAAGGTTGAGGAGTGGAAGAAGACTGCGGCCAACTATAAGAACAGCAGTATCACGCTCGGAAA
GTTCGAGGTAAGCGGCGGCAACGGTGGCAGTGGCCAGATGCCGCTCGAGCAAGGCATGGAGAGGATGAGCTTGCAGCAGG
GTGCCGCCGGTGGTCGGGCCAGCCAAAATAGCTATGTGAGTTGCAATTTCCAGATCAGGCAGAGCCATGCTCGAGAGGTA
CCGTTGGACTAATAGATGTTCTCTTGTATCAGCCGCAAAGCCCTACTGGCTACAATTCGCAGAGGAACACCCAGCAAAGC
ATGCAGGCGCAGCAACAGCTGCAGCAACAGCAGCAGCAGCAACAACAGCAGCAACAACAACAACAAGGACCGTACGGCAC
CGATTCCAGATCTTCACAGCTGTTTGCGCCTATTTCGGCACACATTCCCCGTTACTGTTTTGCCGAAGACAAGTATTGGT
TTGTTATCGAGGCTATACTGGAAGATGGTCGTCAATGGGAGCTGTCACGATACTACGAGGATTTCTACGACTTCCAGATT
GCACTTCTGACCGAGTTCCCGACCGAGGCTGGCAACACTGGGAACAAGAAGCGCACTCTTCCATACATGCCTGGTCCCGT
CAATTACGTCACGGACGCCATCACGGAGGGCCGCCTTCACAACCTCGATGCCTACGTCAAGAATCTGTTGGCACAGCCGC
CATACATTGCACGATGCGATCTCGTGAAGCAATTTTTCAGTCCTCGCCAAGGAGACTACGAGATTGAGATGGAGCTGGAC
GAAGAGCAGGTTTCTCCCAGGTCTCAGCCACACCCGGGCGACATCAGTTTTGATCGCCCCCCCAGCCAGCTCGACAGCGG
GTACTCCACAGGGGCGTCGGCCGGCCGGGCTCAGCAGCCGTCTATGGCACGACAGCCGTCATCATTGTCGCAGCCGTCGC
AGAGCTCATTGTCGCCGGGCGTCAACCAGCAGCCGGTGCAGGCCATGAAGGTCAAGCTTAGCTACGACAACGATCTGGTG
GCTATCCGCGTGCCATTGGATATCCCGTTCCGCGACCTGTACGACAAAATCCGTGACCGGTTGAAGATCTCGGCTGCCGA
CCAGATGCAGCTATTTTATAAGGACGATGCCACTGGAGACAGGCCGAGCATGCTGAGCGATAACGACCTCGACACGGCTT
TGCAACGAAACGAGAAGCTGACGATCTACATTGAGACCTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62