GenePrediction:GLEAN_4057 Details

Name: GLEAN_4057
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2512090..2513238 (+ strand)
Length: 1149
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2512090..2512111 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_113:2512190..2512254 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_113:2512310..2512620 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_113:2512743..2513238 (+ strand)
Length: 496
>GLEAN_4057 class=GenePrediction position=GCSC_113:2512090..2513238 (+ strand)
ATGCTCATCATCTCCGGAATGTGTAAGTTCTCGTCCGACCTTTTGTCCCATCACCGTGTTTTTTGAACTGTTGACTGACC
GCATTTGATTGATCCTACAGACAGCCAGCTTGGTGTGGGCTGCCCACTTTCAGAGGCCCTAATAAACATCCCCTTGATTC
TCAGAGTGTGTGACCATTTCGACTGCATTCCCTACAGGTCCCTTCTGACGTCTGGTCCAGCTCCTCGTTGCTTACGAACT
GATATTTGCCACGTCGACCTTTACGATAAAAGTCTCGGTTCTGCTGTTCTATCTTCGAGTTTTTGTCACTCCCGCCATGA
AGCTGGCCGCAAAGCTCACCCTCGCCTTTGTGGTGCTGTGGACGGTAGGCAATATCATGCAAGTGTTTCTGATCTGCCGG
CCTTTTGCCGCGACGTACGACACAGATGTGCCGGGCACTTGCGGCAATCAGGTGGCAAGCTTCATTGCTATTGGGTGCTT
CAACATTGTCACCGATGTGATCATCATTATTCTTCCAATCCCTACAGTCTGGTCTCTGAAGACGTCTGTCAAGGTTCGGA
TCATGCTGACGATTGTCTTTCTGATCGGCTTTCTGCAAGTATTCCCTCAAACTCCTTGCACAAGTGTGTGTACTAATATG
GTCCCCGACACAGTGTCAGTGTAGTGGCCATTGCACGCATTGTCGCCTTGACAAGACTTGATATGAAGGCAAACTTGACC
GGTACCATGATATACGCCGACTTCCTCTCGGCCGTCGAGCCCAACCTGGCCATTCTTTGTGTCAGCCTGCCCATGCTACG
GACACTAAAGTCCCGCATGAGAACAAAGGGGCGCTATGACCCATCGACCAGCAGATCTGAAGGCCAGCTAGATAGCAAGA
AGTTCGGCGACTCTAGGCATGTGCGACTCACGGGCGACATGCCCGCAGAGAGCTTTGCCATGAAAACTGTTTACGCGGTC
AACCCAGGCGGCGATTACAATGCCACAATCGTAAAGGGAGGAGCGTCGCAAGAGCACAGTGATGACATGGAGAGCCCGAC
TGGGTCTCAGACCGAGCTGGCCCCGTCCGTTCTTAGCGATGGCCATCCGAAGCAGGGCATCATTGTCAAGACGCGAGTGG
AAACGCGCTGGAGCACGCCATACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62