GenePrediction:GLEAN_405 Details

Name: GLEAN_405
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1577148..1578833 (+ strand)
Length: 1686
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1577148..1578833 (+ strand)
Length: 1686
>GLEAN_405 class=GenePrediction position=GCSC_167:1577148..1578833 (+ strand)
ATGAACCCCCCGCCACCTGATCCGTACAAAGCACTTGGGGTTGAAAAAAGCGCCGACATCACCACCATCAAGTCTGCCTA
CCGCAAACTGGTCTTGAAGTGCCATCCCGACAAGGTCCAAGATCCGACTCTGAAAGCGGTCAAGCAGGATGAGTTCCAAC
GCGTACAGCATGCGTACGAGGTCCTCGTGGACGAGACGAAGCGGAGGGAGTACGATCTTGATGCTAAGATGCGGCGGATG
AGGGCAGAGGCTGTTCGGAACCCATCGACGCCCCGGTCCACGGCCAAGGATTACGCCGGGTTCAATGTCCGAACTGCCGA
ACCCCCTCCGTCCTTCAAACCCGGCCCGCCGCCATCTTACTCACCCTATGGCGCGAGCAGTCCTCTGCATGCGCATTCAT
GGGAGGACCGGGATATGCCTTATCGATCAAAGACAATGTACGATGAGGGTCGCCGAGCCCGCCGCGCAACGAGCTACGAG
AAGCCGCGGTCCGAGGTTCCGAAAGAAGAACGGAGGCGCCAAAAGGAAGCGGATGAGGAGGCGGACCGAGGGTGGGCGCG
AGAGAGGGAGCAGCGAGAGAAAGACCGGCGCGAACGAGAGAAGGAGCAGGAGAAGAAGGCCCGCAGCGAGCGCGAGAAGG
AGGAGAAGCGTGAAAAGTTGAAGAGGGAGCAGGACCGGCGTGATAGAGAGCGGGACCGGACTCGTCGTCAGGAGCAACAG
GACAAGGCGCGAGCGCGAAACAAGACGGCTTATGTCGAGCACTACGAAGAATCGGACGAGGAGCGCCGAGCATACAGCAA
GAAGAAGACGTCGGCCAGTGGTGCTGGAGGCGGCGGCAGCAGCAGCAGCAAGAAGCACACGGAAACACCACGCCGTGACA
GGTCTGCCCGCCGTGATGATGAGCCGCGTACAGAGCCGCGTGTCGAGTCCGAGGCCGAAGCACCGCCAGCCGATGCAATG
GAGGAGAGAATGAAGGCCGCTGCTGACTACATGGTCACGAAGCGACGGGGAAGCAAGAACAACATGCCGACGGCGCAGTT
TACCGAAGGGACCGCTTACAATTCCCACTTCCCGGATCCGGACGTGACCTGGCACGTTAACGGGGCTTCTCCGCGGCCAC
GCCGTGCTTCCCAGGAGGAGAAGAAAGTCCGCAGAGGTGACGGCCCTGAAGACGACGTTGACCGCTTCATGGGGACGCCG
GAACGCCGGCCGCCGCCACTGACCAAGTCGTATACGACGCCTTTGGGCACGGTACACGTGTCGAACACTTCTGCGCCTCG
TGCTCCTCCACTCAATCGAGCCGCGACCATGGGCTACTCGCGGCCGATGCCGCCATCGGTGCCCCCCGCGGCACCGGAAA
CGGGCCGGGGCAAGCCGGAGCGTCGACGCCGAGGCTCGTTTGAAGCGTTGGACGAGGAACTGCGGTCTCGCCGGCCGTCG
GCCAATCCTCGGGTGGTGCACTATCCGCTGGACGAAAGCTCTCCGATCCCACGCACGGGCAAGTCGAACTACTATGGACA
CGGGAACGACTATTTTCCGGCGCCTTCACGGGCGAAGACGTTCTCGGGCGGACAGGTATACGAGACAAAGCGGTACTCGA
ATGAGGATATTGTCTACTCGACGGTCAACCATTCGGCGGACCACCACTACTCGTCATCGCACCCGCCTTTTGTGGCGTAC
GACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62