GenePrediction:GLEAN_4060 Details

Name: GLEAN_4060
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2523905..2525544 (+ strand)
Length: 1640
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2523905..2524672 (+ strand)
Length: 768
Type: CDS
Source: GLEAN
Position: GCSC_113:2524722..2525151 (+ strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_113:2525210..2525544 (+ strand)
Length: 335
>GLEAN_4060 class=GenePrediction position=GCSC_113:2523905..2525544 (+ strand)
ATGCGGACTCTCGAAGACGAGATCAGGTCTGCGTCTACGTCGACCGTCCTCACTCTCTTCCCAGACATCTGTCCAGACTA
TCTGAAAGAGAAGAGCGAGGAGCTGGCCTACGACCACGAGTCAATCGTCGGGCACATCCTGGACCAGGTGGAAAAAGGCT
TCCCGTACCCGAAGCGTGCTGGTTTGAAGCGAAAACGACAGTCCAGCAGCAGCGGCCACAGCCTAGATGAGGAGCATCAG
AAGAAGATCCAGGAGGACGAAGCCGTCCTCAAATTCAACAGCGATGACCGCCGCCAGCTGAAGAAGCCTGCGGAGTATGT
GCAGATATCCAAGACGCTTATCCAGCAGATGTTCGTCTTTGTCCCACAAAAAGACATCGCAACCATTCTCGGCACTCACG
GCAATTGTCTCTTCCCTGCGATTTTGGAGCTGGAAGCGACAATGGCAGAGACCTCGCCCGAGGCCTTGCCGTTCAAGCTG
AAAAAGACCAAGACCAAGAAGCTGCCAGAGTATTCCCCAGAAAGCCTAGACGGGACCATTCTCGTCACCAGGTCGGCCCC
GAAGAAAGATGCATTGGAGGAGTATCGCGCTGCTGTGGCCATCTGCCAGCAGCGGGAGGAGAAGCGGAAACAGCGAAAGC
AGCTCGATTTGGAAGAGGAACGGAACTTTCAGAACGCCCAGACCGAAGGCACCATAAAAGATTGCGAGTGTTGTTATGGC
GAGTTCGCCTTGAATCGCATGATTCACTGCGATGGAACCTTGTTTCATGTATGGCCACATCCCCTTCCTGTTTTTCAGAG
CCCCCTAACAAGCAAAGTGGTTCTGTAGAGGCTGCTCTCGGCGCATGGCCGAGAACCAGATCGGACTCTCCAAGTACTCC
CTCGCCTGCATGTCCACCGACGGCTGCAAGTCCGGCTTTTCCCGCGACCAGCAGAAGCTGTTCCTGGACGAGAAAACGCG
GATTGCCCTGGAGCGCATTGAGCAGGAGCACATTCTGCGAATTGCCGGCATCGAGAACCTGGAAACATGTCCGTTCTGTC
CTTTTGCTGCCGAATACCCCCCTGCCGAGATCAACAAGGAGTTCCAGTGTCAGAATCCTACGTGCGAAGAAGTCAGCTGC
CGCCTGTGCCGCAAGGCAACGCACATTCCCAAAACCTGCGCCGAGGCAGAACGGGAAAGCGGGCCGTCCGCGCGCCTTAC
TATAGAAGAAGCCATGTCGGCAGCCCTGATTCGATCTTGCAATATGTGTATGTATCTATATCCCCGTACCACTTGCTCTC
TCGGCGGCCATACTGACGCGCCCAGGCCGTACGCCATTTATCAAGGAGCTTGGCTGCAACAAGATGTCCTGCTCACGACC
CGGCTGCAGCAATGTGCAATGCTACGTTTGTCACAAGTCGTGCGACTACGCCCATTTTGACGACACGACCCGTGGAGGAA
AGAAGGGCAACTGTCCGCTCTTCGAGAGCGCCGAGCAGCGCCACGCGGACGAGGTGCAGGCGGCTGAAGAGGCCGCTCGG
AAAGAGGTGGCCTCCAAGAACCCAGATATTGATGTTAATCTGCTCAAGATCAGGCTGTCGGACAGGGTACTCGCCGACGA
GAAGAGGCGTAGGGAGGCGGACGGAGGACGACGACATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62