GenePrediction:GLEAN_4061 Details

Name: GLEAN_4061
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2527809..2533009 (+ strand)
Length: 5201
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2527809..2530179 (+ strand)
Length: 2371
Type: CDS
Source: GLEAN
Position: GCSC_113:2530236..2533009 (+ strand)
Length: 2774
>GLEAN_4061 class=GenePrediction position=GCSC_113:2527809..2533009 (+ strand)
ATGGTGCGAGTCACCGAGGAGCTGGCCGTCTCCCCCGAGGCGGTCACACTCTACTACGCCACGGATCCTCTGCTCGGCCA
TCTGCCCATCCTCGCCTTTCACGGGCCCTCGACGACAGCCAACTTCACGCACAACAGCTCCCGCATCCAGGTCCACATCT
ACTCACCAGCTGGCTTCCAGTCCTTCCCGCGCCTGACCATCTCTCCCAACTCCCCCTTCTATGGCGCCGTCTCCTTTTTG
CCGCGCGAGTTCAAGGGCGACGAGGTCTGCCGTGGCCTCGCCTTTGCGCTCTTCAAGTACTTTAGCGAACTGTCCGACTC
GGTCAAGACCTACCTTCGCAACCAATATCCCACCACACGTGGCCGCCGTCCGGGCTCTGCCCCGGCGCTCTTTGGCGAGC
AACATGCCGCCGACTTGGCCAAGGCCATGGCCCTCGTCGACAGCAACACGCCCGACCTGCTGCACACGCTGCAATGCGCC
TTGCAGGCCCAACATGTCACCAACCTCGATCTTGATCTCGTCCTCCCCCCCGGTGCCGTGACGCCCCTGAAGGCGGAGGA
CCTGGAGACCTCGCCCGAAGATGAGGACGATATCATCCTCGACCCCACCCTGCGGCAGTACGACCCCGCCTACATGCCGC
TGGTCAAGCTGTTTGGCGACCCGGTCTTCCTGCCGACATCGAAGCTTCGGCGTGCCCCTTCGCGGCCCAGCTCGCTCAAC
CACCGCAGCAAGGTCTTCACCAAGGACCAGAAGGTCGAGCTGCGCATGAAGATGGGCGAGCTCGTCGACACCGAGGAGCG
CTATGTGCTCAAGCTTAACGAGCTTGTCAAGCACGTCGCCGACGATTTTCGTCAAAAGGCCGGCGACAGCACGGCCACCC
GCGACAGCCCTACGGTCGACGAGCTCGATCGCCTGTTCCCCCGCTCGGCCGACCGCATCCTGCAGATGAACACAGCTTTC
ATGCAGGAGCTGCGCCGCGTCATGGACGACACGGAAGAAGACGCCGTGCGCGATCTGGAACTGCCGTACAACTTCGGATC
GTCCTCTTCGCGCCACCGTATGGCTGGTGGCAACGGCATCAACGGCGGTGCCGGTGCTGGTTCAGTCCGTGTCAAGGATC
CTAGTGGCGCCCTTAACATGGCCAAGACCTTTCTGGAGTGGTTTCCAAAGTTCACCGACTGCTACCAGGAATACATCCGG
GCGAGCCAGAATTTCCCGCAACTGCTCAACGGCTTTCTGGATCACCAGTCGGGCTTTCGCGACCACGTTTTGCAGACGAT
CGGCGAGCAGTCGCTGCGTTCAATTCTGATCGAACCCGTGCAGCGCCTGCCACGCTACAGTCTCTTCATCGACCAGATCG
TCGGCTGTCTGCCCATCAACCATCCAGCTCTACAGCTGATGCTCAAGGCACGCGACATCATTACCAATATCTGCTCCATG
GACGACCCCCTCGATGAGAAGCCGCAGGTCACCAATCGGTTGCGCAATATGGTCGAATCCTGGCCGGCCGACCTGGAGCC
CAGAGGACGTCTAGTGCTAGCTGCCGACTTTGTTGAGCTTGTGGCACCTTACGATGCCGACGCCTATAGCGTTGGAGCCC
AGGACCGTGCCGGTCTCTTTCTCCTCTTCAGTGACTGTCTCATCCTCGTCAAGAAGAAGCCTGGCTCCGCGGCGACGGGC
CGCGATCTTCTTCGCGAGATCGATAAGCCCTCGCCAGCCGGCTTGCTGGCGTCCATGACCAATGCTGCCGGCGGCCCCGG
CACGTACGATGTGATCTTTAACGGCTGGCACCAGCTGGCCGACGTGCGCTTCACCGAATCGGCCGACGGCCGGCTGGTGT
GGATGACGTCAACACAGGAGATGAAGGGCGGCCAGGCTGGTGGATTCACCTCCAGCAAGACGATCACGTCGCGCTGTTTT
GCCCTGCAGGAATCCTTTGAGGGAAAGGCCGCGCGATGGAGCGAGGACGTGGTGAAGGCGCGTATCGAAGGCCGTTTTTC
CGAGGCCGAGCGGGAGAACCCGACCTGGACCTTGCGGTCTGCACGCCTGATTGAGAGCAACAACATGGGCTTCCATGCGG
CCGTCTTCCAGGAAGGGGCCGATCAGCTCATCGAGGGCAGGCGAGAGCCGGCTCCTGTGCGTGTTGTATTTGACAACCAC
AGGGGCACTAAGGGTGCCCCCATCGGGCACTATGGCGTCGAGATCGTCGTGGAGGTGCGCATTGATAGCGGCAGAGGCAG
CATCGGCAGCATTGGCCGGGGTAACTATAATGACTCTCGGCGCCTGGTCATGAACGCACTGGGGCTCAACGGCAAGCGGT
ACACAGATGACATTGCCATTGAGGACTTCCTGCCGACCCTCTCGAGGAGGAGTAGGTGTATTTGCCCCCCCTTCCTCTTA
GACTCGTCCTCTGACATGGCCTTTTAGTTATCCAACTCACGAGTGCCCAATTCAACACGGCCAACCCCAAGTTGGTGCCA
GCGCTAGTGTCTTATAATACCAAGACGCTGCGTTCTTTGAATTTTAGTGTGCGTATCGAAAAGACAAAGTCGTTCCTTGC
CTCAGGACCCGGAAAGCTGTTGTCGAGCTTCTTGGGTGGAGGCACCAACAACTCTCCGATTGGAAACAACAGTTCTGCGC
ATTCCAGCTCGTCGGATGTGGGACATGGTTCCATCAGAGGGACACGATCACAGCCTGGGAGTCTGTCACATTCGGCCAGC
AACAGCCGCCATCAACAACAGGATAGCACCTCGCTGAATAGCTCCCTACGAGATCGTGACGGGGGGCGACCTACGCCAGA
CATAACTCGGCCGGAGAACCCCCTTGTTCGGCTCGAACAGACATTTACCGGCTACGTGGCAGCGATCCAGGCACGGAAAG
GCCAGTTTGTTGGCCGCTTGTTGCTGAGCCGGGCATCCAGCACGGCGGACGAGCTGTCGGTCAACCTCTTGTACAACAAG
CTGAATGAGAGTCCATTTGATTGGGAGTCATCGTTCGACCTGCCGCCCGACGTTGTGTTTGCAGCGTTTGAAAAATTCTC
TCGCATCGCGTGGCGCGATCAGATGGGTACCATTATGACTATCCAGTTGCTGGACGCGCTGCAGGAGCGTGCGGCTCGGA
AAGTGCCCGGCGACTTTGCCGACTTTGTCAAGTACCTGTTTTCCGACATGGCACCGCAAAACCGACGGGCGTTCACGGCT
CTGATCAAGCTCCTAGCCGATCTGCTCGACGGTTGCGACGATGACGGAGACCGAGGCGCGCTGACCCTGGCCTTTGCCGA
GTTGCTGGTTGCGGACAATGGGGAGCCACACAACTACATCAACCTGCTGGACCTGTTGGTAGAGGACTGTGACCGGATCT
TTGAGGACAACTCCTTCGGGACGAGCCTGCAGATGCGGACTGCATATGAGTCGTTCAACTCGACAGCTCGGAGCCAGAGG
TCAGCAACCGGTTCGGTCACGTCCAACACATCATCACTCCGCCGTAAGTTTGGGCTCGAGTCACTCCTCTATCGTCAGAA
TAGCAACAACAACAGAGGTGGCAGCGCTGCCCTGGAGGCCATAGTGAGCGGCGTCGGCAGCAGCAACGCGGAACCGGAGC
GGCCTTCGATGTGGCGCAACCTGAGCAAACACAGGAACCCGGCTACGGGCGACAATCTTCCGGGGACCAGGACACTCGTG
TCATCGCGAGTTAACCGATCCCAGTCCATCGACATGGGCAACCAGTCGCCGATGGGCAGCAGATCGATGAGACGGCCGGC
GTCGCGAGATCGGCCTCCCATAGCCGGCGCCTTTGACGAGATGCGGCCGTCGAGCTCACACCGGCCGACTAGCTCACAGC
AGCTCGAGACGATTGGCGAGCCGGACGTCGAGCCGGTGACGCCGGTGACGCCGGTGATGATAATACCCGAGAGATCGTTG
AGACGGAAGCGGCGCAGCTCGCTGTCCGATCTCAAAAGTCTGATGGCAGCGGCCAGCCTGGAGGAAGACGCGATGGCGTC
GGCGCCGCTCATGGCCACGAACGGCCTCGAAGACAGTCCTCTGGCACCAGCGCCGCTGATGACTCCGGGTGGCCTCGAAG
AGAGTCTCTTGCCTCCGGCACCGCTGCGGACGAGCAAGACGACATCGGAAAAGTCCAACTCGGGCCCACCGCCCCAGACA
CCTTCTCCGCATAAGATCACGACCAGCCCAGAGTCGCAGAATTGTAAGCCATTGCAGCCGTCGCCAGAGCAGCAGCAGCA
GCAGCAGCAGCAGCAACAGCAACGACCGGCCCTTCAACGGCACCAGCGACAACAGAGCCAGCCCTCCGTTGCGTATCAGC
CGTCTCCACGGCAGAAAGAGAACGGAGTGGAAACGCCGACATACAGAACGGCGCGTGTTCGCTCTCCGTCTTCCTTTGTT
GCGCTCTCCGACCTGAACATGCAGGGCCACGGCCACAGCAAGACACTTTCTGGGTCCAGCTCGTACATCCCGACATTGAG
GGCTCCCCGTGGAGCAGGCGTGCTGTCTCCAGGCGGCGATTCACCAGCGTCTTCGCTGCGGTCACCATATCTGCCGCCTC
CGAGTCCGAGCAAGTTTTCGTCGGGATCGACTTCGCCAACGCGAACGAATTCGGCCCCAGGCCAGAAGCTGCGACTGCAG
TCACCACAGAAGCTTCGGGAGCGGCTGCAAACAGAGAAGGAGGCAGTAGGTGAGGCAGATGCGTCGCTCAAGACAGAGCT
GTCACGGATCGCAGCGGATATGGCCCGTGTGAACAGTGGCGGTGCAGTGAGCCCACTGGGACTTGCGTCGGAAGGTACAC
CGTCTCGAACAGGTGTTGGCACGGATCTGCGGCGGCTGGAGAGCAGCCTCAAGGCACTGGAGGAGCATGTGTCGCAGGTG
ACGCAGTCGCTGGCCGACAAGCAGGAGGCGCTACAGCTGGACATGGACAACTCGGTCAGGGTAGCGGAGGCCAAGGTCCG
GGCCATCGACCAGCTGTACAAGGAGGCGACGGCGGAGAACGAGCTGCTGTACGAGAAGTTCAACACGGAGCTGGGCAAGA
TTGTCAAGGCGCTCAAGGGCAAGGGCCGCGACGACAAGGAAGAGCTGGTGACGCGGCTGAAGGAGCAGAGCGAAGAGACG
GCGCGGCTGAAGAAGGAGAATGCACGGATGCGGCGGGAAGCGGTCAGTCTGCGGACGTTGCTCAAGGCAGGAAACAGCTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62