GenePrediction:GLEAN_4062 Details

Name: GLEAN_4062
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2534793..2538367 (+ strand)
Length: 3575
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2534793..2535175 (+ strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_113:2535226..2536951 (+ strand)
Length: 1726
Type: CDS
Source: GLEAN
Position: GCSC_113:2537023..2537597 (+ strand)
Length: 575
Type: CDS
Source: GLEAN
Position: GCSC_113:2537665..2538367 (+ strand)
Length: 703
>GLEAN_4062 class=GenePrediction position=GCSC_113:2534793..2538367 (+ strand)
ATGGACGATCTCGTTCGCCTGCTCAGCGACACGCAACGGCCGGAGGAGGAGCCACGCAAGCGAGCCGAGCTCGACCTTCG
ACACGCCGAGTCCAACCCCAGCTTTCCGGGCCTGCTGGCAGCCATCGCGGCGACGTCGAGCTATCCGGTCGAAATCCGAC
AATCGGCCCTCTCGGTGCTCCGGCGGTTCATCGAGCGCAATTGGACCCACGACGCGGAGGACGAAGAGGATGACGAGGAC
AGCGACGACGACGACGCAGGCACGAGCCCGGCCGGCCGGCCACGCTACACCGTGACGGATGCCACGAAGCAGGAGCTGCG
GGTACAGCTGCTGGAGCTGGCGACACGTGACGAGGACGACCGCCGGATCAAGCCGGCCGTGAGGTGTGTATTCTCCTGCT
GTCTTTGCCTTGGGTCCTCGCTGACGGCGACAGCTACGTGGTTGGTAAGATCGCCGCGGTCGACTACCCAGACCGGTGGC
CCGACCTGGTGGACCACCTGCTGAGCGTGATCCGCAGCGGGACAGACGTGCAGCTGCACGGGGCACTGCGGGTGCTCGGC
GACCTGGTCGAGGACGGCCTGAGCGAGACGCAGTTCTTCGCGGCGGCACGCGGCATCATCGAGGTGCTCTACCTGGTGGC
GGTCAACGGCAGCCGGCGGCCGATGCTGCGGGCGCTGGCCGTGTCGGTGTTCCGCAACAGCTTCGACCTGATGGACATGG
TCAAGGAAGAGCACCTGCTGGAGGTCAAGGGCTTCGCCCAGGAGGCCCTGCAGGGCTGGCTGCCCTTTTTCCACGAGATC
ATGAAGACGCCGCTGCCGCTGGACCAGCCGGTGGCCACGGACAGCGGCCAGCAGTCGGAGAGCTGGAACGGACTGGTGGC
GCTCAAGCTGCAGTGCGTCAAGACGCTGCTCAAGATCAAGGCCGTCTTTGCATCGCTGCTGCTGCCACAGAGCCCGGCCT
TCTTTGAGGAGACGTGGCAGGAGCTGTCGCTGCTGCAGGGCGCCTACGCCCAGTTGTACCTGGACCAGGACAGCCAGAGT
CGGCTGGAGGACGCGGACGGGCTACCGTACACGCTCGACTTTCTCGTGCTGGAGGAGCTCGACCTGCTGAACCAGTGCAT
CCGCGCGCCGCCGGTGCAGAAGGAGCTGGGTGGCCAGCTGAGCGCCAGCGCGGCCGCTCACGAGACCCCGTGGATGGTGC
AGCTGATGCGGCTGCTGGTCGGCTACGCCCGCATCACGCGCGAGGAGGAAGACCTGTGGGACATTGACGTGTCGCTGTAC
CTGGCCGAGGAGGCGTCTATCACGGCCAACTACACGGCCCGGACGGCCTGCGGCGACCTGCTGATCAAGCTGGGCGAGTG
GATCGGCCAGCACGCCCTGGAGGGGCTCTTTGCCCACACGCGTGCCGTCTTTGCGGACACGCCGGCAGCCTGGCGCTCGC
AGGAGGCCGCGCTGTACCTGTTCACGATGCTGGCGGGCGACCTGATCGACTGTGACAAGACGATCCCGGCCGAGATTTGC
GCGGCTTACCTGCCGCTGGTCGACGTGGCCGTGGCGGCAGCGGCCGACGAGCCGCTGCTGCAGGCCCGCGGCTACCTCGC
GGCCGGGCTGCTGGCCCAGAACTTTGCACCGGCCGGCCGGCTGATGGACCCGGCCATCGTGGCGGTCACGCAGGCAGCCT
CGGAGCTGGTGCAGGTGGCCTGCGTCAAGGCGCTCGACAGCTTCATGCAGGCGACGCCGGCCGGGACGAACATCAACAAC
ATTACGACCTCAGGCTCGGCCACGACGTCCATCGCGGCCGGTCGCCAGACGGCCATCCTGCTGGCCCTGCGCGAGTTTCT
TAACAGCCGCGACGTCGACGACCTCCAGGACGCCGACGACCTGCTGGCAACGCTGTGCGATTCGCTGCGCCGCGCCATCA
GCATCAACCCGGCCGTGGTGCTGGCCGACGACGTGCCCTCGGTCGACCTGCTCTTTGCCATTGGCCGCTGCGGCGCCCGC
AACTTCCACGTCACCCTGATCGTCAACGAGGCGTTTGAGGAGATTTTGCAGCGGCTGTCGGACCCGACGTCGTACGTGAC
GCTGTGCGCCAAGGTGCTGCCGACGCTGAACGGATTCTTTTCGTACTCGGACCTGACCAAGGACGAGCCACTGATAACGG
TGAGTGGGGGAGGAGGTAGAGAGAGACAGACAGAAAACGAAAGAAAGCGAAAAAACAACTAACAGAATAGATGGCCACTG
AGCTCATCGCTCTCCTCACACAAAACGGCACGGAGCCACTACCGAACGGATTCGTCGCACAGGTAGCGCCCAAGCTGAAG
CGCATCCTGATGGAGTCGAGCGAGGGCGAGATCCTGCGGCCGGGCGCGGAGGCGCTCAAGAACATGCTCAGCCACGACCA
CCACCAGGTCTTTGAGTGGCACGACGAGCAGGGCAACAGCGGGCTGGTGGTGTGTCTGCAGATCATCGACCGGCTGCTCG
GCCCGGCGATCGAGGACAACTCGGCGTCCGAGGTGGGCGGACTGGCGGCTGAGCTGGTCGAGAAGGCCGGCCATCAGCGG
CTCGGCGACGGAATGCTGCAGCGACTGCTTCAGGCTGTGGCCGTGCGGTTGAGCTCAGCCACGACGGCTCAGCTGATCCA
GTCGCTGATCCTCGTGTTTGCCCGCCTCTGCCTCACGGCCGCCGGCGAGGTGGTCGAGTTCCTCAGCCAGATCACCGTCG
GCCAGCAGAACGGCCTGGCCGTCGTTCTGAGCCAGTGGCTCGAGAACTCGATGAGCTTTGCGGGCTACGATGAGATCCGG
CAGAAGTGAGTGTGGGCGTGTAAATTGTGTGTCTGTGATTGTCAGGTTATGCTTACTAATCGAACTCGCTAGCGTCATTG
CCCTTTCCAAGCTCTACGAGCTCAACGACCCGCGCGTCAGCGAGACCCAGGTCAAGGGCGACCTGATCATCACGCAGAGC
GACTGGATCATGACGCGGTCACGGGCCAAGCAAAGTATGCACCACCACCATCCGCTCGCGCCTCCGGCCAGCGTGAACCC
GGTCACTGACTTCTTTACCCTGCCCCCCAAAGATCCGGACCAATACACCATCATTCCGGCGCCGCTCAAGATCCTCAAGC
TGCTGATCGAGGAGCTGACGTCTGCCCAGGGTCAGCTGGGCAGTGCCGGACTGGGCGCGGGCGGCACCGTGGCCGCCGAG
ATGGGTGTCGATGGCAGTGTGGGAGGCGGTGCAGGAGCTGCCAGCGCAGGAGGCGCAGCCGGCGCCGTGGCCACATCACC
GACCCATAGCAGCGGCGGTGACGATGACGGCGCGGTCAACGATGATGGCGGTGCCGACGACGGCTGGGAGGACGAGCCCG
ACGACTTGCTGGACCTCAGCCTCGGCGCCTCCAAGGCCGACCTGCTCTCGTATCTAGACGGTGGTCGCAGCCGCGTGCGT
GACGATGAGACTCAGGCCTACCTGACCGACTTTTTCCTGCACGCCGCCCAGGAGAACAAGGCCAACTTCCAGGACTGGTA
CGCGCGCCTGACGGCCGACGAGCAGGCCAAGCTGAACGAGCTGGCGGCACACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62