GenePrediction:GLEAN_4063 Details

Name: GLEAN_4063
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2547492..2548551 (+ strand)
Length: 1060
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2547492..2547535 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_113:2547603..2547663 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_113:2548519..2548551 (+ strand)
Length: 33
>GLEAN_4063 class=GenePrediction position=GCSC_113:2547492..2548551 (+ strand)
ATGGCATGTCCTCTCGTACCGGAGCTCCGAGACTCCTTCACTTTGTGGGTAGATACCTGACAATGGCCGACCCCGATTTG
GCTTCAAAATGGACTAACTCCTTATTCAAAGCCTTTTCGAGACTGGCTCGTATTCTGACCTCGTTGTCAAGAGCTCCGTA
AAGACTTACAATGTACACAAGGCTATTATTTGTCCAAGATCAGCTTTCTTCAAAGCCGTTTGCAGAGGGTCGTTCAGGGT
AAGCCGAGCCTGCTCGTCGCACTACAGCCGGCTGGGTTACTGACATCTTTATAGGAGAGCTTGACTGGGGTCGTTGAACT
GATCGACGACGACCCAGAGGCCGTCGACTTGATGATGACCTACTTTTACCATCTTAGCTACGATTTGCTTCTTCCGCCGG
GAGTTCCAATGCCAACGTCCCCGTTCAATAGCGCCGGAGTCCGTCGATCGAGCTACAATGAAACAAGCCAGGTGCTCATG
CCGCCTTCGTCCCACCTCATGATCCATGCCAAGGCTTTTGCAATTGCCGACAAATACGATGTACCCAGGCTTTGCACTTT
TGCGACAGATCATTTTAAGCGAGCTGCGGCTCATCACTGGAACACGGATGCCTTCTTAGACGCCGCTGAGTTCGTATTTT
CGAGCACTCCAGCTGCAGCGAAGCAGTTTCGCCTTGCCATCGTCGAGATTGTCATGAAACACTCCTTGGTTCTTGTGGAG
AAGGAGCGGCTTCTAGATATGATCGACGACACAGACGCTTTGGGGGCTTACCAGGAGGTGCGTAAACACAGACGCCTGAT
CGAACGAAACGATCAACTGATTAGGTCGATAATTGCTTCTTCTCGCTGTACGAAAGAGATAGGCTACATTCCGAAGAAGA
TTTATTACAAAACTTTCGCAGATCTGGACAGCGGTCATCCATAGGTGGGTATGATTTATTGGTACTTCAACATACAATAC
AGGTACCGTCTCAGACGAGTACAGCTACGATAGTAACCGCAAAGGAATTTGATGACAGAATCACTAGATTCTGGACAAAC
ACGCCAGGTCTGGAATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62