GenePrediction:GLEAN_4065 Details

Name: GLEAN_4065
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2558633..2560211 (+ strand)
Length: 1579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2558633..2558699 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_113:2558885..2560124 (+ strand)
Length: 1240
Type: CDS
Source: GLEAN
Position: GCSC_113:2560178..2560211 (+ strand)
Length: 34
>GLEAN_4065 class=GenePrediction position=GCSC_113:2558633..2560211 (+ strand)
ATGTCTCCCATCAACAGAGTGCTTCCCGCACGGAAGAACAGCCTCCTTGTCGAGGACGTTCCCGATCGTTAGTTATCCCC
CTCTTTCTTCCCGCTCTCCCACTCTGAAAGGACAGCACCCCCACTGGGCTGTTCTGTCATGCGATTTTCCCCTTCTTCGG
CGGACCTCGTGAACAGGACGTTGAGCTGTGCAGAGAGCGGAAGACACCGTTGAGACGTTCACACCGCTTACCAATTCGGC
TCCTCTCTGCAGACGAGGATCTCGTTGCGCGTCGCCGTCTTGGTCAGACACCGCTTTCGTCGCGTCTGGTTGCTGCCGCG
CCGACCGGCAATGATCGCAGCACTGTCACTGACTTCGACTATGCACATCTCCGCGCACCTCTGCCCAAGGGCATCGTGTC
CGGCATCTTCAAGCCGAGCCCGAACAGCTACTTCTTGATGCGTCGCAGCAGTGACGGCTATGTGTCTGCCACGGGCATGT
TCCGCGCCACCTTCCCCTATGCCGAGATTGAAGACGAGGAGGAAGAGCGCCGGTACATCAAGTCTCGCCCAACCACGAGC
TTGGAAGAGACTGCCGGCAACCTTTGGGTTCCGCCCGAAGCCGCTCTCGTGTTGGCAGAGGACTATGGCATCGTCCCTTG
GATCCGCGCCCTGCTCGATGCCACCGAAATTCCCTACACTCCGCCTCCTGGCAGCCCGAACAAGAAGGCTCCCAAGGCGC
CTCCCAAGCTCGCCCTAAACCACCCGTCTCTCGTTCCACCCACACCAACCTCTGTCGCGCGCAACACTCGGTCCCGTCGC
TCTGCTAGTCCCACTAAATCGGTTGCAACGAAGCCGCGTGCTATTGCCAGCCCTCGCAAGAGGACTACCAAGTCTGCCGC
CGCCGCCGCCGCCGCCGCTGCTGCTGCTGCTGCTGCCTCTGCCTCTGTTTCACAGGCTTCTGAGGCATCTGTTGCTAGCA
CCGAAAGCACTCCAGTGCCGTTGTCTGCTGGCCTCACAAACGGCGACTCGTCAGCAGCAAAGGAGCCGCACGTTATCCTG
CCGTCCGTAGAGGAGGAAGACGTCGTCAAGCCGACCAGGTCGACCAAGTCGGCCAAGGCAAAGGCTGCGGTCGAGAAGGA
TGTCAAGGTTGAAGCCAAGCCCGAGGTCAAGCTTGAGACCAGGCCCGACTATGCCTTTGCCGCCCTGAACCCGCTTCTCC
TCGGCGTGCCGCCGTCACCTGGCGAGTCAGCACGTGCCTTGGCCGAAGCAAAGGAAATGGTCCGGGCCGCCGCAGACGAG
GCCGGGGCTTCCAGCTCGAGCCAGAAGGGCAAGCGCAAGGCAGAGGAAGTCGCAGAAGAGGCGACGAGCGCAAATGACAA
TGCGGCAGATGGTAGCGAGGCGCACCCGTCAGAGCAGCCAAGAGCAAAGAAGGTCAAGACGGAGGTGCAGCTGCGCAAGG
AACGTGTGCGGAAACGAGCACTTTTGGGCGTGGGCGCCACCATTGCCGTTGGGTAGGTTTCTTCGCCACCCAAGCCCAGT
CTGACTGATGACTAACCATTTGCAGTGCTCTTGTTCCCTTTGTAATGGGCATGTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62