GenePrediction:GLEAN_4069 Details

Name: GLEAN_4069
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2579311..2585019 (+ strand)
Length: 5709
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2579311..2579836 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_113:2579895..2584846 (+ strand)
Length: 4952
Type: CDS
Source: GLEAN
Position: GCSC_113:2584906..2585019 (+ strand)
Length: 114
>GLEAN_4069 class=GenePrediction position=GCSC_113:2579311..2585019 (+ strand)
ATGCGGCCCGAGGTTGAGCAGGAGCTCGCGCACACCCTTCTGGTCGAGCTGCTGGCATACCAGTTTGCATCGCCCGTGAG
ATGGATTGAAACACAGGATGTCTTTCTCGCAGAGAAGACAGCCGAGCGTATTGTTGAGATTGGCCCTGCCGACACGCTTG
GTGTTATGGCAAAGCGAACCCTGGCGTCCAAATATGAAGCATACGATGCTGCAAAATCTGTGCAACGACAGATCCTTTGC
TACAACAAAGACGCCAAGGAGATCTACTATGACGTCGATCCTGTAGAGGACGAACCCGAGCCGACACCAGAGGCATCAAG
CAGTGCCGCCGCGCCTGCCTCTGCTGCTTCTACTGCTGCTGCTGCTGTTGCCGTAGCTGCACCGCCCGCCGGCGCCGGCC
CAGCCGCCCAAGTCCCGGATGCCCCAGTCCAGGCGCTGGACATTGTCCGGTCTCTCATTGCACAGAAGCTGAAGAAGCCT
CTGTCTGAGATCCCGCTGAGCAAGGCGATAAAGGACCTAGTCGGAGGTGAGAACCTACAAATGCATGGCCATAGGCATCT
CAATGCTAATCTGGAATTGCACAGGAAAATCCACGCTACAAAATGAAATTCTTGGTGATCTCGGAAAGGAGTTTGGCTCG
ACGCCCGAGAAACCGGAAGACACCCCGCTCGACGAGCTTGGTGCTGCTATGCAAGCCACGTTTAACGGAAGTCTTGGCAA
GCACTCGCAGTCATTGATTGCTCGCCTCATCTCCTCCAAGATGCCTGGCGGTTTCAACATCACAGCCGCTCGGAAATATC
TCGAAACACGGTGGGGCTTGGCATCCGGCCGTCAAGACGGCGTGCTGCTTCTTGCTATCACCATGGAGCCGCCTGCACGT
TTGGGCTCCGAGGCCGACGGCAAGGCTTACCTGGACGACGTTTCTCAGAAGTACGCGTCCAACGCAGGTATCAGCCTGTC
CACAGCAGCTTCCGCTGGCCCGGCGGCCGGCGGTGGTGGTGGCATGATGATGGACCCTGCGGCCATCGATGCCCTAACCA
AGGACCAGCGTGCGCTCTTCAAGCAGCAGCTGGAGCTCCTGGCACGCTATCTCAAGATGGATCTCCGTGCCGGCGACAAG
GCCTTCCAGACCTCGCAGGAATCCTCAAAGGTCCTCCAAAGCCAGATCGATCTGTGGGCTGCCGAACACGGCGACTTCTA
CGCAGCCGGTATCGAGCCGGTGTTCAGTCCGCTCAAAGCGAGAGTGTACGACTCGTCTTGGAACTGGGCGAGACAGGATG
CCCTAAGCATGTTCTACGATATCATCTTCGGCCGCCTGCAGACCGTTGACAGAGAGATTGTCAGCCAGTGCATCCGCATT
ATGAACCGCTCGAACCCGACGCTGCTCGAGTTCATGCAGTATCACATCGACAACTGTCCGACTGAGCGCGGCGAGACTTA
CAAGCTTGCCAAGGAGCTCGGTGCCATGCTCATCGACAACTGCAAGGATGTGCTGAACGTTGCCCCGGTGTACAAGGATG
TAGCCATCCCGACTGGGCCGCGTACCATCATCGACGCCCGCGGCAACCTAAAGTACGAGGAGGTCCCCCGTGCCAGCTGC
CGGAAGCTCGAGCATTACGTGCAGCAGATGGCTGCCGGAGGCAAGATCACCGAGTACGGCACCCGCGCCAAGGTCCAGAC
CGGGCTCTCTCGGCTGTACAAACTCATGAAGCAGCAGCACAAGATATCCAAGACGTCACAGCTTGAATTCAAGAACCTCT
ATGGCGAGCTGCTGCGGTCTCTGGAGATGAACGAAAGCCAGATCATTTCGGCCAACGGGGCGGCCAAGAAGCCCTTGACC
TCCAAGGGCACGCCGAAAGCCAAGGTTGAGACGATCCCGTTCCTGCACATCCGCAGCCAGGCCAGCAGTGGTTGGGAGTA
CAACAAGAAGTTCACCGGGCTCTATCTCGACTGCCTGCGCGAGGCGGCGGCATCCGGTGTCAGTTTCCAGGGCCGGTATG
CGCTGATGACCGGCGCTGGTGCTGGCTCCATCGGTGCTGATGTGCTGCAGGGCCTCATCAGCGGTGGTGCGCACGTAGTC
GTGACGACCAGCCGCTACTCGCGTGAGGTGACCGAGTACTACCAGGCCATGTACGCGCGGTACGGCTCGCGCGAGTCGCA
GCTGGTGGTTGTGCCCTTCAACCAGGGCAGCAAGCAGGACGTCGAGGCTCTGGTGCAGTACATCTACGATCCCAAGAACG
GTCTCGGCTGGGACCTGGACTTCATTGTGCCATTTGCGGCTATCTCGGAGAACGGGCGGCAAATTGACAGCATTGACTCC
AAGTCTGAGCTTGCTCACCGGATCATGCTGACGAACCTCATCCGGCTGCTGGGTGCGGTGAAGACGGAGAAGGCCAACCG
GGGCTTCATCACACGGCCGGCCCAAGTGATTCTGCCGCTGTCGCCCAACCACGGGACATTTGGCAGCGATGGTCTGTACT
CAGAGTCAAAGCTCGGTCTGGAGACGCTCTTCAACCGGTGGCACGCCGAGGACTGGGCGGACTACCTCTCCGTCTGCGGT
GCTGTCATCGGCTGGACGCGCGGTACCGGTCTGATGTCGGCGAACAACATCGTGGCCGAGGGTGTGGAGCGTTTCGGCGT
GCACACGTTCTCGCAGCAGGAGATGGCGTTCAACTTGCTGAGCCTGTTGTCGCCTACGATTGTGGATCTGTGCCAAAACG
AGCCGGTGATGGCGGATCTCAACGGCGGACTGCAGTTCATCCCCAACCTGAACAACGTGATGACCAGACTGCGCAAGGAG
ATCACGGAGACGAGCGAGATCCGCAAGGAGGTGACAAAGGAGACGGCCATTGAGAGCAAGGTTGTCAACGGCGAGAACTA
CGAGACGCTCTACAAGAAGAAGACGATTGAACCACGAGCAAACATGCAGTTTGAGTTCCCGAACCTGCCCGACTGGAAGG
AGGAGATAGCGCCGCTCAACGAGAACCTCAAGGGCATGGTGGACCTGGACAAGGTGGTAGTGGTGACGGGCTTTGCGGAA
GTCGGGCCATGGGGCAACTCGCGGACGCGGTGGGAGATGGAGGCGCACGGTGAGTTCTCGCTGGAGGGCTGCATCGAGAT
GGCGTGGATCATGGGCCTGATCCACAACCACAACGGCCCGATCAAGGGTAAGCCGTACTCGGGCTGGGTGGACGCCAAGA
GCGGCGACCCGGTGGACGACAAGGACGTCAAGGCCAAGTACGAGAAGCACATTCTGGAGCACTCTGGCATCCGGCTGATC
GAGCCGGAGCTGTTCGACGGCTACGACCCGAACCAGAAGCAGCTGCTGCACGAGGTGGTGATCGACGAGGACTTGGAGCC
GTTTGAGTCGTCCAAGGAGACGGCAGAGGAGTTCAAGCGCGAGCACGGCGACAAGGTGGAAATCTTTGAGATCCCAGAGA
GCGGACAGTACACTGTGCGGATGAAGAAGGGTGCCGCACTGTGGATCCCGAAGGCGCTGCGATTCGACCGGCTCGTGGCC
GGACAGATTCCGACGGGCTGGGATGCCAAGCGGTACGGTGTTCCGGAGGACATCATCTCGCAGGTGGACCCGGTGGCGCT
GTTTGTGCTGGTGTCGGTGGCAGAGGCGCTGCTGTCGTCGGGCGTGACGGACCCGTACGAGTTTTACAAGTACGTGCACG
TGTCAGAGGTGGGCAACTGCATGGGGTCGGGCATGGGCGGTGCGACAGCGCTGCGCGGCATGCACAAGGCACGGTTCCTG
GACAAGCCGCTGCAGAACGACATTCTGCAGGAGTCGTTTATCAACACGATGAGCGCGTGGGTGAACATGCTGCTGCTGTC
GTCGTCGGGCCCGATCAAGACGCCGGTGGGTGCGTGCGCGACAGCGGTGGAGTCGGTGGATATCGGCTACGAGACGATCA
TGGAGGGCAAGGCACGGATCTGCCTGGTGGGCGGGTTCGACGACTTCGGCGAGGAGGGCTCGTACGAGTTTGCCAACATG
AAGGCGACGAGCAACGCGGTAGACGAGTTCGCACACGGACGCACGCCCAAGGAGATGTCGCGGCCGGCAACGACAACGCG
GAACGGCTTCATGGAGTCGCAGGGCAGCGGGGTGCAGGTCATCATGACAGCACGGCTGGCGCTGGAGATGGGAGTGCCGA
TCTACGGTGTCCTAGCGCTGACGACGACGGCATCGGACAAGATCGGGCGATCAGTGCCGGCACCAGGAATGGGCGTGTTG
ACGACGGCACGCGAAAACGCCGGCCGATTCACGTCGCCGCTGCTGGACATCAAGTACCGGCGACGACAGATGGAGCTGCG
CAAGCGGCAGGTCCGGCAATGGCACGAAGCGGAGCTGGAGTACCTGGCAGACGAGGTGGCAGCGATCAAGGCGCAGGGCG
AGCCGTTCAACGAGAAGGAGTACGTGGCAGACCGGGCGTCGCACATCGAGAAGGAGGCAGTGCGACAGGAGAAGGAGGTG
CTGCGCAGCCTGGGCAACAACTTCTGGAAGAGCGACCCGAGCATTGCACCGCTCCGAGGCGCGCTGGCGACATGGGGCCT
GACGATCGACGATCTGGATGTGGCCTCGTTCCACGGCACGTCGACCAAGGCCAACGACAAGAACGAGTCGTCAGTGATCT
GCAAGCAGCTGGCACATCTGGGCCGCACCAAGGGCAACGCGGTGCTGGGCATCTTCCAGAAGTACCTGACGGGCCACCCG
AAGGGCGCTGCTGGTGCGTGGATGATGAACGGCTGTCTCCAGGTGCTCAACACGGGTCTTGTGCCGGGCAACCGAAATGC
CGACAACGTGGACCAGGTGATGGAGCAGTTCGACTACATTGTGTACCCGAGCCGCAGCCTGCAGACGGACGGGATCAAGG
CCTTCTCCGTCACCTCCTTCGGCTTCGGCCAGAAGGGCGCACAGGCCATCGGCATCCACCCGCGTTATCTATACGCAACG
CTGGACGAGGCCACCTTTGACGGCTACCGGGCCAAGGTGGCGGCACGCCAGAAGAAGGCGTACCGGTTCTTCCACAACGG
CATGATCAACAACTCGCTCTTTGTGGCCAAGACGCACGCGCCGTACTCGGACGAGCAGCTGCCGTCGGTGCTGCTGAACC
CGGATGCGCGTGTCACCGTCGACAAGAAAACGGCCGAGCTGACATTTGCGGCCAACTTCATGCAGCAGGCGGCCAAGGCA
ACGCTGCCGACGGCCGGTGGCGCCGCGGCCAAGACCACGCTGGAGGCTCTCGAGGCTCTGGCCGCACAGGTGCAGACGCG
CAAGAACAAGGTCGGCGTCGACCTGGAGGATGTGGCCGCCATCCACATCAACAACGACACCTTTGTCGAGCGCAACTTTA
CGGCCGCTGAGATTGCCTACTGCAACAGCACGCCCAATGTGCAGGCCGCCTTTGCCGGCCGCTGGTCTGCCAAGGAAGCC
GTCTTCAAGTCGCTGGGCGTGGCCAGCCGCGGTGGCGGCGCCCCGCTCAAGGAGATTGAGATTCTGCGCGACGACAAGGG
CGCGCCCACAGTTCATGTGAGTTATGTCTGCGATTTCTCTCCAAATGCGATTTGTCACGTGATCTAACAAAACAGCTCCA
TGGGCAAGCCGCAACGGCAGCCAAGGCGGCCAACCTCAAGGAGGTCAACGTGTCCATCTCGCACTCGGACAGCCAGGCGG
TCGCGATCGCCGTGTCGACGTTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62