GenePrediction:GLEAN_4072 Details

Name: GLEAN_4072
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2622035..2624927 (+ strand)
Length: 2893
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2622035..2622071 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_113:2622137..2622263 (+ strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_113:2622347..2623584 (+ strand)
Length: 1238
Type: CDS
Source: GLEAN
Position: GCSC_113:2623643..2624041 (+ strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_113:2624092..2624927 (+ strand)
Length: 836
>GLEAN_4072 class=GenePrediction position=GCSC_113:2622035..2624927 (+ strand)
ATGTCTTCGTCCACCACGACATCGTCGTCGCTGCAGGGTGAGACGCCTTTCACGATCGGCCTCGTTCAGCCACCGTCCGA
CATCTTACTGACATTGTTACAGGTCTTTACCTGACCTTGGCTCCTGTGGCCATTCAGGCGGGCATCTACCTCCTAATCTT
CCTCGTCCTCCGTCGCAGCCATCGTCGTTGGTATGCGCCTCGGACTTACTTGGGCAGCTTGAAGCAGAGGTATGCCTTTT
ATCTCAACCTCCTCTCTCTCTCAACATCGTGATACAACATCGTAATGCTAAGACGCATTTTTCTTTCTGCAGCGAACGGT
CTCCCAGCCTGCCCAATGGCTTGCTCAACTGGGTCAAGGGCTTCTGGGACATTCCCGACACTTACGTCCTCCAGCACCAG
TCCATGGACGCCTACCTCTTCCTTCGCTACCTGCGTGTGCTTGTGATCATAACGTTTGTCGGCTGCGTCATCACATGGCC
AGTTCTCTTTCCCGTCAATGCCACCGGTGGCGCCGGCCAGAAGCAGCTGGATATTCTCTCGTATTCCAACGTCGACAGCT
CTACCTTCAAGAAGCGCTGCCGCTACTTTGCCCACCTCTTCATGGCCTGGATCTATTTCATCTTTCTCATGTACATGATT
TTCCGCGAATGCGTCTTCTACGTCAATCTGCGCCAGGCTTTCCTGCTCAGCCCCGTCTATTCGCAGCGCCTGTCGTCGCG
CACCGTTCTGCTCGTCAGCGTCCCCGAGGTTCTGCGCGACGAGCACCGCCTGCGCAAGATCTACGGCGAGTCTGTCCGCA
ATGTCTGGATCATCCGCGACACCGACGAACTCGAGGAACACGTCGAGGAGCGCGACAAGGCCGCCTTCACACTCGAGAAG
GCCGAGGTCAAGCTGATCAAGACCGCCAACAAGGAACGCCTCAAGGCTCTGAAAAAGGGGTCCGCTTCGGCCGACAAGCC
TAACGAAGACGCCCCGATTGACGGCGATTCTGGAAGCATTGCCGCTCGCTGGCTCCCGCGCAAGAAACGGCCTACTCACC
GCACCGGCCTGCTCGGTCTGATCGGCAAGAAGGTCGACTCCATCGATTGGTGCCGTGAGGAGATCCGCCGCCTCACCCCT
CAGATCAAGCAGGAACAGGACGAGTACCGCATGGGCAAGCCCAAGACGATTCCGGCCGTTTTTATCGAGTTTGACACCCA
GGCTGCTGCCGAGAACGCCTACCAGTCCATTGCGTACCACGAGGGCTTGCAGATGCGCCGCTACATTGGCATCGCCCCGC
CGGACGTCGTCTGGTCGACGTTGAGCATCCCCTGGTGGCAGCTGCTGCTGCGCAAGTATGCCGTCATTGCCTTCATCTGC
GTCCTGATCATCTTCTGGGCCATTCCTGTCGCCGTGGTCGGCGCCATCAGCAACATCAACTATCTTGAGACCATCTCGTT
CTTAACCTGGCTGAAGAAGATCCCGGATATTGTTATGGGCCTCGTCACCGGTCTCCTGCCTTCGGTGTTGCTGTCCTTGC
TTATGTCCCTCGTGCCGGTGGTTATGCGACGTGAGTTCCCTCCTAGTCCTGGCTGAGAAAGAATGATGAGGAGATGCTAA
TTTTGTAGTCTGTGCCAAGCTTGCGGGCGAGCCGTCCAACTCCCGTGTCGAGTTGTTTACTCAGAACGCCTACTTCTGTT
TCCAGGTCATCCAGGTCTTCCTCGTCTCCACGCTGTCGTCTTCAGCCACTGCGGTTGGCAAGCAGATTGCCGACGACCCG
TCGAGCGTGACAGACATTCTGTCGAACAACCTGCCCAAAGCATCCAACTACTACATGTCCTACTTCATCGTGCAGGGCTT
CTCGGTCGCCTCCGGCGTCCTCGCCCAGATCACCGGTCTCATCATCTTCAAGCTGCTCTACAAGTACTTGACTGGTACAC
CTCGCGCCATGTACACCAAGTGGACCAGCCTCAGCGCCATCTCCTGGGGCAGCACTCTCCCGGTGTACACGAACATTGCT
GTGATCGGTGAGTTTCGCTGTCTTCTGGCTTAAATGGGCATAACTAATCATATACAGCGATCACGTATTCGGGCATTGCA
CCTCTGGTTCTCGGCTGGGCGTGTGTCGGCCTGGCCTGCTTCTACCTTGCGTACCGGTACAACGTCATGTTTGTGACAGA
GACGCAGATAGACACACGTGGCCTCATTTACCCGCGCGCTATCAAGCAGCTGATGACGGGCGTGTACTTGTCGGAGCTTT
GCATGATTGGCCTCTTCGGTGCCAGTGTGGCCATCATTCAGTGCGTCATGATGGTTGTCTTCCTGGTCTTCACCGTCCTC
TTCCACATGAGCCTCAACACGGCGCTCGACCCATTGATGTACAACATGCCCCAGAGCCTTCTGGCGGAGGAGGCACTGCG
CCACGACCTGGAGGGTGGCGGCCAGGCGGCTCGTGGATATGCGGGCGCAGAAGGCGGCATCACCAAGAACAGCACGGCCG
AGAGCAGCGGGTCTCGTAGTGTGCCGGAGAAGTACGAAGAGGTTCCTCTGACAGGATCGACATCGCCGGCGCCGCATGGC
AACTTCTTGCAGCGCTTCCTCAAGCCGTGGGTCTACTGCAACTACGAGGCCATGCGGCAGCTGGTCCCTCCACATGAGGG
CCCGGCAGACTTCAACGACATCTATACGCCTGACGTGATACAGCACGCCTACTTGCCACCATGTGTGGGCAGCCAGGCAC
CGACGCTGTGGATTCCGGAGGACCAGGCGGGCATTTCCAAGCAGGAGATTGCCCACTCGAGCGAGGTGATTGACATCACG
GATGAAGGCTGTGTGCTGGACGAGAAGAACGATCTCATCTGGGACGAGGAGGGATCGCGGCCACCTGTGTGGGAAGAAAA
GATCCCTTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62