GenePrediction:GLEAN_4073 Details

Name: GLEAN_4073
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2632477..2633546 (+ strand)
Length: 1070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2632477..2632777 (+ strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_113:2632874..2633129 (+ strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_113:2633183..2633546 (+ strand)
Length: 364
>GLEAN_4073 class=GenePrediction position=GCSC_113:2632477..2633546 (+ strand)
ATGGCTCGACCTGTCGCTATTCTTCTGGCCCTGACTGCTACACGGGTCTCAGCTTCCTTCAGCTTTCCTAGCTTCCGCGT
GGGTGCCCTAGCCAAGGCCACCGACGACCCGGGCTACGATGCCTGTGTCACGGCTGATGCCCAGATCAGCGCGTGCGTGA
CTGCGATTCCCTCGGGAGCGGCCCTCTCCGTCTATGCACAGTGTTTATGCTGCGAGGAGGCTCTCGATGTTGCCACGGTC
TACGGCGAGTGCGAGACCTACGTTGCTCTGTCGGCACCTACTGCTACGGAACTGTATACGGGTGTGTTTTGATTCTTTTT
CTCGTTTTCTTTTTCTTTTTCTCATTTTGTCTCTTTCACTTCCCTCTCCCCGGTCTCCCACCCTTCTAACAAGTCAGTGA
TGGCCGGCTTCGACAACTCCTGCCAGAGTGCCAGTGAGGAAGGCTTCTCTTGTAGCGGTGGTGCCACCACCGTGCTAGCC
ACGGCGACGTCGTCTTTCGTCGTCACGTCAGCCTCCGCCACGGCTGGCCAAACGTTTGGCAACACCGGCTCTCCGCCGGC
CTGCACATCTGTGGCATCGGTCTACAACTCCTGTTCCAGCAGCTACCGCGGTTTCACCACGATGGTCGATCATGATGCGG
CCAGCTGTGTCTGGTGAGTTTCCGTCTGGTCCATCCCGTCTTGCCCATCTTTCTGACCATCCGCAGCTACGAGGGAGGCG
AGTACACGACTGCCTTTGACGACTACGTTGCCGGTTGCGTGCCCTACGTCAAGACGGCCGACCCGACAGACTACTTTGAC
TACTACGCTCTCGAAGGCTTCTGCGCAAGCTACCCGCCAGACAGCGGCACTGCCCACTTTGGTTCTTTCGCAGCCTCGAC
TACCGCCCCAGTCGCCAAGACCACAGCGGCCGGGACTAGGAGCACGACTACGACCACTCCCTCGACCACGGCCCCCGGCG
GAACTGTCACGGTGACTCCGACCGTGGCGACCAAGAACCCCGGCGCACACGTCGTCGCCAACGAATTATTTGCCTGGGCA
GCCGCCATCCTTTCGCTGGCCATGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62