GenePrediction:GLEAN_4077 Details

Name: GLEAN_4077
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2642527..2646366 (+ strand)
Length: 3840
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2642527..2644366 (+ strand)
Length: 1840
Type: CDS
Source: GLEAN
Position: GCSC_113:2644427..2646366 (+ strand)
Length: 1940
>GLEAN_4077 class=GenePrediction position=GCSC_113:2642527..2646366 (+ strand)
ATGTTCAAAGTCAAGGCCATCTACGAGTACTCGTCGGCCCACGATGACGATCTGAAGTTTCCTGTCGGCCAGATAATAAC
TGTCACGGAAGAGGAGGACGACGAATGGTTCTCGGGCGAGTACACCGATGACTCGGGCGTGCATCACGAGGGTATCTTTC
CGCGGAACTTTGTCGAAAAGTACGAGCCGGTCGCTCCGCCCCGGCCGACGCGGACCCGTCCCAAATCTTCGGCTGTTTCG
TCTTCTACTGCTGCCGCTCTCGCTGCTGCTATTCAGGAGCCTTCCTCCCCTCCGCCTCCGCCGTCTCCGAGAGCTCTTGC
CCCGCCGGCAGAGGAGGATGAAGAAGAAGAGCCTGTGCCCGAAAAGGCCTCTCCGCCCGCACCTGCGCGAGCTGCCACAC
CCACCTCGTCTCCTCGGAAACCGGCCGCCTCCGTGGCACCGTCGTCTCCCATTGTCATTTCCAAGGCAGCGCCGGTATAT
TCTCCGGGTCCCAAGGCCGCACATTCCCCGATTGTGCCAAAACAGGGCGGCTCGCCGCCGGCTGTGGCGGAGAAGCCGAT
TGGCAACTCGTTTCGCGACCGAATAGCCGCATTCAACAAGGCGGCTGCTCCCCCTATCACACCTTTCAAGCCTAGCGGTC
TGGCCGGTGGTGGGGGCGCTAGCAACTTTATCAAGAAGCCGTTTGTGGCGCCCCCTCCGAGCCGCAACGCATTCGTTCCT
CCGCCCCGAGAGCCTTCGACGACGAAGCTGTACCGGCGGGATGAAGACCCCGAGATCCGAGAACGAGAGGCGGAAAATCT
CGAAAGCGCCGAGAGGGCCGGCTTGCTTCCGACAGCGTCAGCTGCTGGTGGCCAAGCAGAAGAAGAAGAAGCCAAGCCGA
TGATGAGTCTGAAGGAGCGTATGGCCCGTCTTCAGCGGGAGCAGCAGGAGCAGGCACACCGACATGCCGAGGCTGCTGCC
AAGAAGGAGAAGCCGAAGCGGCCGCCAAAGAAGCGGCTGGACAGCCATGACTCGGCCGCGACGGCGACTGCAGTTGCAGT
AACCCCGACGACGGACGAGACCGGTGGCGTGGCACAGCAACCGCCGGCTCTCGAGCGGAGGGACACGGGCGACACGGGCG
GGCGGCGCTCGGTGGACGAGAGCCACCCGCCGCGTGTTCCCCACGCACCCCGTCGAAAGGCGTCTAAGGACCCCGAGGCG
CAAGACGGAAACGACGCGGACATGTCGGGGGCTGGCGACACGACGGAAGGGCAGGACGACGAGCAGGCCGAGCGGGACGA
CAGCGATGAGAAACCGAGACAACTGTCTAAGTCGGCGATTCCCAGCAGCGAGCGACCGGTCGAGGAAGCAGCCAAGGATG
AGGAAGAGGAGGGTGCGGGCGAGGAGACGACGGCGAAAGAGGAAGAAGGAGAGACCGAGCCGACGGAAGCGGCAACAGCA
ACGGGGGAAGAAGAAGAAGAGGAAGATGTTGACCCCGAAGTGCGCCGACGAGAAGAGCTGCGGGCAAGAATGGCCAAGAT
GAGTGGTGGGATGGGAATGATGGGGATGCGAGGCATGCAAGGCATGTTTGGAGGGCCGCCGCCGCCGCCGATGATGAAGA
AGAAGATGCCGGTAGTAACGCCGGAGAGACGATCGAGCGAGGCGACGGAGGAAACAGTGGCGGCTGCACGTGCCCCTCCG
GTTCCGGCGATGATGGCACTGCCCGGACTGGCGATGCGGCGATCTGAGGACAAGCCGGCAGCTGCATCGCCAGTCGAGGC
GCCAAGAGCGGCGAGTCCAGCTCAGGACACCGAAGAGAGTGGAAGCCAGCCGGCGAGCACGTCTCCTCGCAGTCCTCCAG
GTAAGATTTCGGAATGTTGGTGCAGCCAGGTGACTGCTACTCTTTCTAATGGTAATATAGTGCCGGCCCGAGCGGCAGCC
CCTCCTCCACCGCCCCTGAGCACGCGGCCAGTGCCACCGATGCCGCCACTTATGTCGACTCAGGGTCCGACAGCAACGGA
CGGGTCCGAGTCGGATAACGAGCTTTCGAAGCAGACGTCGATTGTGTCGGCGGAGACGCCGCGAGCAGAGGCACCGCCAC
CACCACCACTGCCGGCGGCAGCCGCAGGCCCGACATCACCGATATCGCCAGTATCTTCCGGACCAGCGCTGCCCAACAGA
CGCAACAGCCGGATACCGCCGCCGATTCCTGGCTCGGCACCGGCACCTCCACCGATGCAGGCGCGTCCACCGCCGCCACC
GCCACCGCCGGGGAGCCTCAGCCGCCAGTCGACGATGGAGGCACGGACACCGCTTTCGCCGACGATGCCGACGGCCGGCA
CAGAGGCAGCGGCCAGCTCGGATGACGACAACGAGGAGGAGGTTACAGAGTACGAGGGAGACTACGACACAGATATTGGC
AATCCAATTCCACACAAGAACTCGCTCAAGGCACACGCACGCGATTCCAGTCTGGAGGACAGCGCATCTCTCAAGTCGCC
CATCTCGGAGAGGACGCCATCGTTTCCGCCGGTTCCACCACCGGCTCCGCCACCGGTTCCCAGCGCATCGCGAGTACCAC
CGCCTATTCCTAGCCAGCCGCCGCCGCCGCCGAGTCTGCCGCCCCAGGCTCCTCCGCTGACGATAGCCGAGAAGCGGCGC
TCGATCGACGTGCCCCGAGGCCCGCCGCCACCGCCACCGCCACCGCCACCGCCAATGGAAGCTGATGGGCTTGAAGAGGA
TGAAGGCGAAGACGAGGGTGACAAGTACGACCTGTACAGCCACGTGGCCGGCTCAGCCGGTCCAGCCAGCGCGCCGGCGT
TGGTTCCGGGGCAGCAGTCACTTCTGAGCAGCGAGCTGTACACGCCGCCAGACCTGTCGCTGGCGTTTGCACCTGGGCCG
GCGTCATCATCGGCAACGCCACGGGCACACCCACCCGGTCCTCCACCACCGCCGCCGGCTAGCCAGGCGCCTGCGGCATC
GCTGCACAGCAGCCGAGGTGCGCGGCAGTCGCTGGACGTGTCGCGGCCGAGCGTGGCTGGGGGCAGCCGGCGGTCGGTCG
ACATGGTGCGGCCGTCGATGGAACTGGGCCACGTGGCCAATGACATTGACCTCGCACCGCTGTCCGGCTGGTGGCTGCAG
GCCAAGAACCTGCCGCCACAGCTGCAGGGCCGGCGTGACATCTTCTTCGAGTCGGAGGACTCGCAGTCGGCGAAGCGCGA
CGGCTCGATCGAGATGACGCGCGACATTTACGTGCTGTACCTGGACTACTCGCAGACGGTGATCACGGTACGGTTCAACC
CGAAGGACTCGGCGGACGTGCAGCTGGAGCAGCGCCATGAACCGCCGCCGCGCAGCCTGCGACAGGACCAGCTAGAGCAG
TCATACGAGCGGTTTGGACGGCACATGGCAGACTCGGTGGTGGCGAAGAAGGATACGGTGGTGGGAGACGGCACGCCGCA
GGGGCTGGTGACGGAGCTGATCCGGCCGTTCCGGGATGCGCTGCTGCCGGTGGGCACGCGGGCGTACGGGGCGCTGGTAT
ACTCGAATCTGGCGAACGCAAGCACTATGCAAAATGACGAGATCCGGGCAGGCGACATCATCACGCTGCGCAACGCACGC
TTCCAGGGCAAGCACGGGCCGATGCACGCCAAGTACAGCATGGAGGTGGGCAAGCCGGACCACGTGGCAGTGGTGAGCGA
GTGGGATGGGACGAAGAAGAAGGTGCGGGCGTGGGAGCAGGGCCGCGAGAGCCGCAAGGTGAAGCTGGAGAGTTTCAAGC
TGGACGACCTGCGATCGGGCGAGGTCAAGATCTGGCGCGTCATGCCGCGCAGCTGGGTCGGCTGGGAGGGCCAGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62