GenePrediction:GLEAN_407 Details

Name: GLEAN_407
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1591435..1592390 (+ strand)
Length: 956
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1591435..1591491 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_167:1591592..1591837 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_167:1591908..1592390 (+ strand)
Length: 483
>GLEAN_407 class=GenePrediction position=GCSC_167:1591435..1592390 (+ strand)
ATGGACGACTTTGTCAGCGAGACTGACAGCGAGTACACCAGCTATTGGCGCGACTGGGTGCGTTCCTGGCTTCCTCCCTC
TACCGCCTCGTGCTCTCCTCCTCGACTTTGACCCTTGAAATTGCCATGTAGCTGACCAGCTGTGCCCATGCTTGCAGTTT
ATATCCTCCAGAGGAAACGAGTACTTCTGCGAGATTGACGAGGACTACCTCACTGACCGCTTCAACCTCACCGGGCTCAA
CACCGAGGTCCAATACTACCAGTATGCGCTGGATCTGGTTACCGACGTGTTCGATCTCGACTGCGACGATGAGATGCGCG
AGACCATTGAGAAATCGGCTCGGCATCTGTATGGCTTAGTGCATGCGCGCTACATTGTCACCACGCGCGGCCTGTCTAAG
ATGGTATGCTGCGTGGCCCCCCCTTTTGGCTGAAGAAGGCGTGCGCATTGGCTAACAACAGTCTGCCCGACAGCTGGACA
AGTACAAGAAGTCCGACTTTGGCAAGTGTCCGCGCGTCAACTGCCACTCCCATCCTCTCCTTCCCATGGGTCTCTCGGAC
ATTCCCAACGTGCGGCCGGTGAAGCTGTACTGCGCCCGGTGCGAAGACATTTACAACCCCAAGTCTACGCGCCACTCTGT
GATCGACGGGGCGTATTTCGGCACATCCTTCCACAACATCCTCTTCCAGGTGTACCCGGCCCTGATTCCGTCCAAGTCCG
TGGAGCGCTATGTGCCTCGCGTGTTCGGCTTCAAGGTTCACGCGTCGGCAGCCCTGGTCAGGTGGCAGAACGCAAAACGA
GATGAGATGAGGCGGCGACTCCGGAGGATGGAGATCGACAGCGGGTTCAAGGACGTGGACGATGACGACGTTGAGCTGGA
CGAAGAGGATGAAGACATAGACATAGATGAGCATCACGTGACCGGGGAGAACGGCACCTTGACGGTCATGGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62