GenePrediction:GLEAN_4081 Details

Name: GLEAN_4081
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2657535..2659485 (+ strand)
Length: 1951
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2657535..2657558 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_113:2657620..2659485 (+ strand)
Length: 1866
>GLEAN_4081 class=GenePrediction position=GCSC_113:2657535..2659485 (+ strand)
ATGGAGGCATCCCCGCTGATCAAGGTATCTTACGATTGGTCAAGCAGCGGTCTGTTCTCATTTGTCTGCTGACCAGCTGA
ACCAGGCGCACGACCACGCACGAGAGGCGTCCATAGCCACCCATTCACTGGACACGACCGTTGCGGTCACAGAGCATGCA
CTTGCGGCGGGCGAGTTTGCCACGGCAGCTCAGACCACCGCCAGCACAGAGGCTCTACGAACGCTGAAGCTGCTCGAGCA
GCACCACGAACGGTTGTCCCGGCTGCTGCGATACTCGATCGAACACCCGACACAACAGCAGAAGAAACAGCAGCAGGAGC
AGAAGCAGCAGCAGCAGCAGCAGGAAGTGGGGGGTGACACAGCGAACGAGAAGGATGGAACAGCAAGCACGGCAGCAGGA
GGAGCCAGCAGAACGACGACGGCATCTGTGTCGGGCGTAGTATCGCGGGGCGAGTTCTCGAATGCGAGCCGATCGCGGGC
AGAGGGCCAGACGGGCTTCGACCAGACGGAAGCGGGCAGAACAGGCTCGGCGGCGGCAGTGTCCATGTCGGCGACAGCAG
CAGCACATCAAGCGGGCGCAGCAGCGATGGCCAGTGCGCTGGGATCGTCCCCGTCTTCTCAGCCGCAGCGGCGATACCCG
GCGACGCGCGAGCTGTCGTCGTCGATTGCCAACAATTTGGCATCGGCGCGAGGCATCCGGGGACGACACCGCGGGCAGCC
AGCAGCGCCCAGCATGTCCAATGAGCAGGCGCCCGGCAATCTGGACGGCCAGCTGGGCGGCAGCCCGGACGGGTCGCGGA
CGCACATGCAGAGCGTGCTGCAACAGCTGCCGGACGGGAAGCCGAGCTGGGTGCCGCCGGGTCACGCGTCGGTGGCAGCG
GTGCCGTCGCGGCTGAGCGCCGAGAAGAGCGAGGGCCATCTGAGCCAAAAGAGCTGGGACGAGGACCAGGCGACAACGAA
CACGGCCACGGCCGTCTCGGCTCCGGATGACGGATTCTCCCGGTTCTACAGCCGGTTTGGCAGCTTCATCAACCGGCTGT
CGGCGCCGCTTGCCTTTGCAGGACTGCCGCTCATCGCCGAGGAGCCGGGCAGTGTGGCAGGCGGAGGCGACGCCACAGAG
CAACCGCCGGTCGAGCAGCAGACGGCACCACATCCCATCCCACCGCAGCGACGGCGAAGCAGGCCGCCGTCTGTGATGCT
GCCGACGTCGCCGCCGTCGTTTGGGGCCGAGCCGGAACTGTCCAAGATCTATTCCAAGGCGGCGCTGCGGGCGATCGGCC
GCGACGGACACAGTGCGATGGACTCGTTCTACGTGGTGCCGCGGACGGGCCACACGGCGTCGTACGCCAACATCCTCAGC
TTCGACCAGAAGGAGAGGCGGCGGATGGCGGCGTCGGTGCATGGCGAAGAGGAGCTGCTGGACCATGGCGACGAAGACGC
GTTTATTGACGCGAAGGATTCGCAGCAGAACGGGCGGCGGGCAGTCCGGGGCGGTGGACGCGAGGCGCAGCACGTGGTCG
AGGAGCTATACATTGAGAACCAGAGCCTCAAGGACATGCTGGACAAGCTGAGCAAGCGGCTGCACGCGTTCGAGGCGAGC
GCACAGCACTCGCACATGGCGCTGCAGGAAAGCATGCGGCTGATGCGGCCGGGATCGCCACTATCAGCGAGCGCTATGGG
TGGGCGGCCGGTGATGGAGTATGGAGGAGGAGGTGGTGTTGGTGCTCCTTCCGACGAGATCCCAAAGCGGATGACGGAAC
TGGAAATAGAGCTGACACGGGCGCTGCGGCAGCTTGAAGCGTCGGAGAAGGAACGGGCACACCAGGAGAAGACGCTGCAG
CGGTACCGCGACAAGTGGGAGAAGCTCAAGGCGGACGCCAAGGCACGCAAGGGTGCCCAGATCCAGGGGCAGGGACCGTC
GGCTTCCGATGGGACAACGACGCCTCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62