GenePrediction:GLEAN_4082 Details

Name: GLEAN_4082
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2664112..2666171 (+ strand)
Length: 2060
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2664112..2664678 (+ strand)
Length: 567
Type: CDS
Source: GLEAN
Position: GCSC_113:2664805..2665228 (+ strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_113:2665291..2666171 (+ strand)
Length: 881
>GLEAN_4082 class=GenePrediction position=GCSC_113:2664112..2666171 (+ strand)
ATGGACTACAGCGCCTCTATCAACGATTCCGACAACGCCGGTGTCGATCCCTGGGGATCTCCCGAGGCATCTCCCCGCCG
CCACCAGACCGGCTTTCGGCCAGCGTCCGATCCGTCGCAGTCGCCGTATCAGCAGCCGTTTGATACCGCTCATATCGCCT
CGGGGTCGGACCGATCCGATGCCGGCATCTTTGGCTCGGACAACCCTGACTATCAGCGTCCAGAAACTGCCACCAGCGTC
CGGTCCAACACCAACACATATACGGATGGGAGCTTAGCCGAGACCTTGGTCGGCCCCGGCTATGATGGCGACTCTGCTGC
GCAGTACAATCGCCAGGAACAGTTCCAACAGCTGCCGCCGCCGCAGCAACAGCATCAGCAATATGGCCAAGGTCCACTCC
CTCCCCAACCGAATGAATCCTCCAGATTTTCCAGCGAGACCGCTACCGATCCTCTGGTCGCTGCTGGGCCTCAACGGCTG
CCTCAGCCCAAGTACAAGCTCCAGGCCAAGATCACCGCACTGGAGCGCACCGGCCGCAAAGACCCCATTTTGCGGTTTGA
CGTCCATGTAAGCAGCTTTCCTGTGCTTTTATCGGCTTTCGTTCCCCTTACTTTGCCGTATGCTTCTCTGCCAATTGCTC
CTCTGCTAATAGACGGTTATCAGACAAACCTCCCCAGCTTTCGAACCACGCAGATACGTGACATTCGCCGTCTGCACTCA
GAGTTCGAAAAGCTAGCAGAACACCTTATATCGGCCAACCCCGAAGCCCTCGTGCCTGCAGTACCACCGGCCTTGACATC
GGCCGGTGCCGGCACGGAGGAGGACGAGGCCCGCGTGAAAGCGTTGATGCAGCGCTGGCTCAACTACGTGTGCAGCAACG
AGGTCCTGATGCACGACGACGAAATGGTCCTGTTTGCCGAGAGCGACTTTGGCTACAGCCCCATGCACAAGAAGAGGCAG
CCGGCGACGGGCGTGCGCCGCAAGATCCTCAAGCAGTTTGCCCCTCCGGCTGACGACACGCCTGAGCTGCAGCAGGCGCG
GCCCGCAGTCAAGCTGTTTTACCTTGGCACCATGGATGCCGGTCACAAGGTGGACAAGCTCGTCAAGGCCCGAAGAGGTG
TGTGTTTAATCGAGGGGCCTTTTACCTGTGAAGCTGCTTGCTGACCTGACCGTTCCCAGGACTGGGACTGGCCGAGTCGG
ACTTTGGTGTCAAGCTGGGCGCCATGAACGTGCAGGAGCTGCACCCGGGGCTGGCAAACGCATACCGGAAGCTGGGCAAG
GTGATCCAGACGGCAGGCGACTACCAAGCGGCGCAGGCGACGGCGGAGGCGACGACTCTGGGCGACCCGCTGGCATACCA
CTCGACAGACGCGCTGATCTTCAAGGAGACGCTGACAAATCGCCAGCTGCTGGTCCGCGAACTGCTGCAGGCACAGGAGA
ACTCGCGCAGCCGGCTCAACGCAGCCGACCGACTCAAGGCCAGCTCGAACGTGCGTCGCGAGAAGGTCGACGAGGCCATT
GCCGCGCACGCCGACGCCCACCGGCACGAGTCAGAGCTGATGCAAAAGACAGCGCGCGTGACCCACAACCTCGTCTATGA
GCGTCGCCGCTGGTTCGCCCGCACGTCTGCCGACCTGCGCCTCAGCATCCGCGAGTTTGTCATCCGCGAGATCGAGGCCG
AGCGCCGTACTCTGTCGCTGCTCGAGACTGTCCGTGGCGACATCCGCAGCATCGACAACTCCGGTGGCCTCAGCCGCCTC
AACCGCGAGTCTCATCCCGCTACCGTGCGTCGCGTCAACCTGGCCTCCAGCCAGGGCCCCAAAGGCGACGCCTGGAGCGG
CGTACCGCGTCGCTCCGACGCCCTTCTCGGCCGTGGTTCTGTCAACACCACAACGGGCGACGACGGCACCGAGGACTTTG
ATGGCGCCAGCGGCTCCGTCGCTGGCGTTGCTGGCTCAGGACTGCTAAAGGGCTTAATAGGAGCCGTCAGCGAAGAAGAG
GACGACGACCGGGTGGATGCGCGGAATGCGGCCAGCCGGTTGGCTACGAGCACGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62