GenePrediction:GLEAN_4083 Details

Name: GLEAN_4083
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2670497..2671939 (+ strand)
Length: 1443
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2670497..2670604 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_113:2670698..2671068 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_113:2671126..2671939 (+ strand)
Length: 814
>GLEAN_4083 class=GenePrediction position=GCSC_113:2670497..2671939 (+ strand)
ATGGCTCCCACCGCCATGGTTGCAGAGGCATACTCGCCGCTGCCCACATTTTCCAAGGCATCGACTGTTAGCGCCTCTGT
TTTGCATGGCCCATGCGACCTGCGACTGGTGAGGACCCTCATTTCCCTACCCCAGATCCGACGGACGGACGAGATCTTAG
GTCTTTGGCCGAAGCATACTAATATAATTTGTAATATCCAGGAAGTACGAAGTATTGAAGACCCGGGTGCCGGCGAAGTG
CAGGTCGCCATAAGATCGACAGGAATCTGCGGCTCCGATGTGTCTTACTACAAGAAATTTGCCAATGGAGACCTCTGCGC
CTGCATGCCCCTGTCTCTGGGCCACGAGTCGTCTGGGGTCATTGTGGCCCTGGGCCCTCAGGTGACAGGTTTCAAGATCG
GCGACCGAATCGCCCTCGAGGTTGGTGTGGCCTGTGGCAGCTGCACCGTCTGCAGAAAAGGGCGGTACAATCTGTGCAAG
CAAATGCGCTTCCGGAGCAGCGCCAAGAGTGTGCCACATTTCCAAGGCACACTACAAGAACGCATCAACCATCCAGCCCA
GTGGTGTCACAAGTACGTTCCCTCTTCTCGCTCGTTCAGGAAGGAAATACATGCTAACGCCCCTTTCAGACTTCCGGACC
ACGTCTCCTTTGATGCAGCTGCTCTTCTCGAGCCTCTTTCGGTGGCCATCCATGCTGTGAACCGGGCAAGCCCTCTGCCC
GGCTCTACGGCCCTCGTCATCGGAGCTGGCACCGTTGGCCTCCTGACAGCCGCCGTGGCACGCGCTTCTGGCTGCTCCGA
GGTCACAATCACAGACGTGGACGAAGGCCGGGTCAACTATGCTATCGCTAAGGGTTTTGCTACACATGGTTTGGTGGCGC
CACGGCCATTGAACCTTTCGCCTAGTAGCTCGTCCATCTATACGGAGAGCTCTGGCACATCGACCCCGGCCGAGTCGGGT
GCTACGACGCCAGCATCTATTTTCTCACTCTCCAGCCAGCTGGATGGTGCCAAGAGCCTTGCCGCTGACCTTTTGGCACT
GACCGCTCCCCCGGCGCACTTGCTTTCGGACGAGGAAAACGAAGGTTTTGACCTGTCTTTTGAGTGCACCGGCAAGGAAG
TCTGCATGCGTACAAGTCTGTATGCCACAAAACCTGGCGGCAAGGTGGTCATGGTCGGCATGGGAACGCCCATCCAGACA
CTGCCACTATCTGTTGCGCACCTCCGGGAAATTGACATCATTGGCATTTTCCGTTACGCCAACACATATGCGACTGGCAT
CTGCATGCTTTGTTCTGGTGCTATTCCTAGCCTAGACGACATGGTGACACATCGGTTCAAGGGCCTAGATGCGGCCAAGA
GTGCCTTTGAGCTTGCCTGCCGTACCGCGGACAAGGACGGCAACCTTGTGATCAAGGTTGTGATCGAAGCCTCAACGGAT
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62