GenePrediction:GLEAN_4085 Details

Name: GLEAN_4085
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2676592..2677922 (+ strand)
Length: 1331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2676592..2677468 (+ strand)
Length: 877
Type: CDS
Source: GLEAN
Position: GCSC_113:2677690..2677922 (+ strand)
Length: 233
>GLEAN_4085 class=GenePrediction position=GCSC_113:2676592..2677922 (+ strand)
ATGCTTGAGTATTTCACCTACAAGAAGGTCAAGAAGCACCGGCAGGAGACGAAGGCGAAGGAAGAAGAACAAAAGGCAGC
AGCGGATGATGTGCTGGACGCAGACGAGCAAATGTTTCTCGAGCGGCTGACGCAGACGGCGAGCCATTCGGACGGTGAAG
ACGGGGATGACGGCGATGGAGAGGGTGACCGGCCGGCGCTGCCGCCACGGGCGAAGACGCCGGAGCTGATTTGGGACAGC
GAGAGCGAGTCGTTTGTGCGGGAGGACGAGCGGCGCGAGAAGGAGACGAAGGGAACGAAGGAAGCGTCGACGTCGACGGT
GCCATCGACATCGACGAGCAGTTTCGGGCGGCGTCTGTCGCAGCTGCTGGGGCCACGAAGGGACAAGAGCGCCGCCCATC
TGGTCGTTCCTGGCCGCGCGGACGTGAACGAGACGACGGCCGAAGAGGAGGCGCGCGAGCGCGACGAGATGGCGCGGGTG
CTCGAAGAGCTGGACCAGGCAGCGAGAGGAGACGAGGACGAAAACGACAAAAACGACAAGACCAAGACCAAGGCCAAGAA
GATGGCCTTTGCGCTCTCGTCCGAGTCGACGGAGCTGGTGCGACGGTTCGTGGTGGTGCTCCGGGATCTCGTCGGCGGCG
TGCCGACGGCAGCAGACGATCTTCGTCATCTGCTGGACGATCGTGACGGCACGCTCTCGCGCGGTTTTGAGCGGCTGCCG
TCGGGCCTGCGCAAGCTCGTGGCCCAGCTGCCGGCCAAGCTGACGACATCGCTGGCACCCGAGCTGCTCGCGGCCGCGGC
CGAGTCCCAGGGACTCGCGTACGAGCACAAGGACGGCTCGACCCGCCCGACGGCGCCAAGGCCGCCGCCAAGGCCTTGTT
TCTGCCGCTGCTGACGAAGCCGAGCTCGGTCGTGAAGATGCTCAAGGCCATCATGAACGCGCTGAAGCTGCGCTGGCCGG
CGTTTATCGGCACGAGCGCCATCTGGAGCGTCGCCCTGTTCAGTGAGTCTTGTTCTCGTTCTTCCCTTCCTTTTCCCTTT
GCCCTTTCACTTTTCTCCTCTCTTCCCTCTTTCTTGCCTCTCCAATGCTAACGTTCAGTCCTCCTCTTCGTCCTCTGGTA
CTGCCACAAACGCGGCCGTGAGGTTCGTCTCGGAAACGAGGCTCAGGCCGCCGCTGCGTCTGCTGCTGCTCTCGATACTG
CCACGTCCGTGACCATCGAGGCACCCGTGGCCATCCGTACGTTTTCTCCCGACGACGTCGACGTCCTGCCATCCAGCCAC
CTGTCACCACCACCTATTGGCAGCGGGGCGGCTGTGCCAAAACCGGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62