GenePrediction:GLEAN_4086 Details

Name: GLEAN_4086
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2680752..2683139 (+ strand)
Length: 2388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2680752..2682767 (+ strand)
Length: 2016
Type: CDS
Source: GLEAN
Position: GCSC_113:2682822..2683139 (+ strand)
Length: 318
>GLEAN_4086 class=GenePrediction position=GCSC_113:2680752..2683139 (+ strand)
ATGGTGGCGGTTAAAGGAGGCGTGTGGACGAACATTGAGGACGAAGTACTCAAGGCAGCCATCTCCAAGTATGGGCTGAA
CCAGTGGGCACGAGTGTCGTCGCTTCTGGCGCGAAAGACGCCCAAGCAGTGCAAAGCACGGTGGAACGAGTACCTCGACC
CGAGCATCCGCAAGATCGAATGGAGCAAAGATGAGGACGAGAAGCTGCTGCATCTGGCGAAGCTGATGCCGACGCAGTGG
CGGACGATCGCGCCGATAGTCGGACGGACAGCGAACCAGTGTCTGGAGCGATACCAGCGGCTGCTGGACGACGCGGAGCA
GCGCGAGGCATCGGAGCTGGGGCTGACGGGAACGGATGGCGGCGATGCGCAAGCTCCGACGGCCGACAACGTGCGGCGGC
TGCGGCCGGGTGAGGTGGACCCGGACCCGGAAAGCAAGCCGGCGCGGCCGGACACGATCGACCTAGACGAAGACGAGAAG
GAGATGCTGAGCGAGGCGCGGGCCCGTCTGGCGAACACACAGGGCAAGAAGGCGAAGCGAAAGGCACGCGAGCGGCAGCA
GGAAGAAGCGCGGCGACTGGCCAACCTGCAGAAGCGACGGGAGCTGAAGACGGCGGGGATCAACATTAAGGTGGTGACGC
GCAAGCAGGGCGAGATGGACTACAATGCGGATATTCCTTTTGAGAAGAAGCCAGCGATGGGATTCTACGACACGAGCGAG
GAAATTCAGCGCAACGAGCGGCAGCGGGAAGCCTTTGACCCGCGGCAGCAGAGCACGACAAACAAGCGCAAGGGCGACGA
AGGCGAGGACGCCGGGCGAAAGAAGCGCAAGGGCGACAAGGACGGCGACCAGGCGGCACACCAGGCGGCCATGAAGGCGG
GCCAGATGCAGCGGCTGCGCGAGGCCGAGCAGAGCAGCAAGCGACGGGCGTTGGTGCTACCGGCGCCACAGGTCAGCGAG
ACCGAGCTGGAGGAGATTGTCAAGATGGGGGCGATTGGCGAGCGGGCCAACATGCTGGCACGCGAGAGCGAGAACGAAGC
GACCCGTGGCCTGCTGCAGAACTACTCGACCGTCCAGACGGGTGCACCGATCCGGACGCCGCGAGCAGCACCCGAGGAGG
ACCGGGTAGCCAACGAGATCCGCAACATCCGCGCCCTGACCGAGACGCAGTCGTCGCTGCTGGGCGGCGAGAACACGCCG
CTGCGCGAGGGCGCCGGCTCGACCGGCTTCGAGACAGCCACGCCGCGCAAGCAGGTACTGGCGACGCCGAATCCGCTGGC
GACACCGCTGCGTAATGGAGGAGGGACGGGCGGGGCGTTGGCGACACCGCTGCGTCCAGGGCAGACGCCGTTGCGGACAC
CGCGGGACGGTTTTGCGCTCAACGCAGGCGGCGAGCCGATACCGGTGCGAAGTCGGCTGGCCCAAGGCCTGGCGGCGCTG
CCGAAGCCCAAGGATACCGAGTGGGACCTGGAGCTGCCCGAGGCGGAGGAGGAGGAGCGGCGACAGCAGGCGGCAGCAGA
CGAGGCAGCCCTGGTGGAAGATGCGGCCGACCGCGACCGGCGCGAGCGCGAACGGCTCGAAGCTCAAGAGCTGCTCGCGC
GCAAGCGCCGCACACAGGTGATGCAGCGCGGCCTGCCACGACCGTCGACCGTCGATCTAGCAGCCCTGCTGGAGAAGGCA
GCTGGGCTGGACGATGCGGCCGAGGCGCTGGTGGCGCATGAAGCCGCCCTGCTCGTGGCCAACGATGCGGCTCAGTATCC
GGTGCCGGGGTCGAGGAAAAAACAGACAGGGTCGGGGACGGCACCGCAGCTGGATCGCCTGGAAGACGGCCTGCTGGCCG
AGGCGCGGCTACAGGTGCTGCTGGAGGCCAGAAAGGCCCCGGCCCCAGAAACAATCACATCGGCCTGGGGCGGGCTCGTA
CACGCGGCCGCTGCTGGCACGAATGCGCTGCTGCTTGGGCTGGGGTGTTACGACGAGGACGAGGATGAGATGGAGCGGGT
GCGCTCAGCATTTGAGGTATGTGTGTGTGAGAGAGTGTGTGTGTTTGTCTTGAACCAAGCTGACCAACAGTCGGTGCACG
AGGCAATGCTGGCGTCGGCCGAGAAGGGCGCCAAGCTGGAGAAGCGGCTAGCCGTGCATCTGGGCGGCTACAAGCACCGG
GCAGACCTGCTGCGCAACAAGATGGGCGAGGCGCACGAGGCGTTGCAGCGGGCTGAGGCGGCGCGCAATGGCTTCGAGAT
CCTGGCCCGGTCGGAGGAGGTGGCCATCGGGCGACGGCTAGCTGCACTGCGTCAAGAGGTCGCGTACGTCAGCCGACGCG
AGCGCGAGGCCCAGGAACTGTATCGGGCCAACCGAGAGGAACTGGCATCGCTGGGGGTCAGGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62