GenePrediction:GLEAN_4087 Details

Name: GLEAN_4087
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2684253..2689284 (+ strand)
Length: 5032
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2684253..2684503 (+ strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_113:2684786..2685115 (+ strand)
Length: 330
Type: CDS
Source: GLEAN
Position: GCSC_113:2685175..2689032 (+ strand)
Length: 3858
Type: CDS
Source: GLEAN
Position: GCSC_113:2689092..2689284 (+ strand)
Length: 193
>GLEAN_4087 class=GenePrediction position=GCSC_113:2684253..2689284 (+ strand)
ATGTCAGCGGCCGGTCCATCGCCCGACGCCGATGCCGCCCCGGCTTCTGTCAGCTCCGGTCCCGAATCCGGCTCTGTTTC
CAATCCTCCGGACTCGATGTCGACGAAAGAAGCAGCCACAAGCACCAGACCCCTGTCTCTGCTTTCATCGGAGCCGGGCC
TGTCCAGTGCCACCGCCACCGTCACCGGCACCATTGACAGCCTGAGCTCGACTGCTGCCAACAGCCAGGCCACACGTCCT
TCCACCGCCTCGTCTGTCTCTTCCTTTAGCACGGCACTCAGCTCTTCCGTCGTGGCTCCTGCTCCAGCTCCAGCTTCAGC
GTCTGCTTTAACTTCTGCTTCAACTTCTGCTTCAGCTTCAGCTCCAGCTACAGCGTCTGCTTCAACTTCTGCTTCAGCCT
CAGCTTCAGCTCCAGCTACAGCGTCTGCTTCAACTTCTGTTCCTGCTACTGCTCCTGCTCCTGCTGCGGTTATCCCCTCT
TCCCATCTCCATGACACTCTCGCGAGACGGGTCTCTCCCCTAGTCACCCAAAGAGCTGCCGATGCTGGCGCTGCCAACCG
GACGCCTCAATCGGCCTCTACTTCCCAGCCGTCACGGTCACGCAGCCGCGTACAGCGGCGCTTCAGCGGCAGCACCGCCC
CCAGCAGCCACAGCCCGAGCAGCGACCGCAACTATGTCCACAAGAAGGAGGAGGCTCGTCCTGCTCCGTTGGGCGTCATT
GGCGTCTGCGCCCTCGACGCAAAGGCTCGCAGCAAGCCCAGTCGCAACATCCTTAACCGCCTGATCGCCAAGAAGGAGTT
TGACGTCGTCGTCTTTGGCGATAAGGTCATTCTCGACGAGGAGGTTGAAAACTGGCCAATATGGTGAGTTGTTGCATGTT
CTGTTGTTCTGCGGCCCTTTCTCCTGCTAACGAACCCCTCAGCGACTACCTCATCTCCTTCTATTCCGACGGCTTTCCGC
TCGACAAGGCTGTCGCCTATGTCAAGGCCCGCCGGCCCTTTTGCGTTAATGACGTACCGTTGCAGAAGATCCTCTGGGAC
CGCCGTGCCTGTCTCCGTCTGCTCGACAAGATCGGCGTGCCCACGGCCCAGCGCATTGAGGTGACCCGAGACGGCGGCCC
CAGCGTTCTCGGCCCCGACATCACTCGCCACATCCGCGACCTCAGCGGCGTCGTCATCGAGCCGACGGATCCCAGCAACG
CCCAGCTGCCGCCGACCAAGATCGAGCTGCTGGACGATGGCGACGCGCTCTGTGTCGACGGCAAGATCATCCGGAAGCCC
TTTGTTGAAAAACCCATCAGCGGCGAAGACCACAACATCATCATCTACTTTGCCAATGCGACCGGCGGTGGCGCCCGCAA
GCTCTTCCGCAAGATCGGCAACAAGAGCTCCGAATACGTTGCCGAGCTGAGCATTCCACGGGCCATCACCCATCCGACCG
AGAGCTACATCTACGAAAAGTTTATGCGCGTCGAGAACGCCGAGGATGTCAAGGCTTACACCGTCGGGCCCAACTACTGC
CATGCCGAGACCCGCAAGTCGCCCGTCGTCGATGGCATTGTCCGCCGCAACACCCACGGCAAGGAGATCCGCTACGTCAC
GGCCCTGAACAACGAGGAGAAGGAGATTGCGAGCAAGATTTCCACTGCTTTCGGCCAGCGCGTCTGTGGTTTCGACCTGC
TTCGTGCCGGTGGAAAAAGCTATGTCATCGATGTCAATGGCTGGAGCTTTGTCAAGGACAATAACGAGTACTATGACCAG
TCGGCCAACATCCTCAAGGAGATGTTTATCAAGGAGAAGATGCGCAAGGCCGCCATTGCTGCCGCCGCCGCCGCTGCCGC
CGCTGCTGCTGCCATCGCTGCTGAGGCTCCAGCCCCTGCCGCTGTCCCTGCAGCTGCCGGCACCAATGGCTCCCCGCCTG
CTGCCGGTATGGTCACGACACCGCCTACGATATCGCCGGCAAAGTTCGACAGCGAGCCTTTGACTGCCGCGCAGAGGGCC
CTCCAGCAGAATCTTGACAAAGACAATGAAAAAGTACTGTCTAGATCTGGGACAGTAGATTTCAACAGCGAGGGGACACA
GCAGAAACCAGAGCCACAGCCCCAGCAAACCCAGCCACAACCACAGGAGATACACGAACAAGCAAAGCCCATTCACATCC
TTAACAGTGCAGCTGACGATATCGTCCAGACTGCAGATGTATTTATGCCTAAGCCCAAGCGCTCTCCATCAAGCTCCACC
ACAGCCGCTGCATCTCTTCCCATTCCTGTGCCTGCTCAAGCCGCAGCCAACAGTGGTGCCGAGTTTTCCACCAGCGGATC
ATCTACAGCCGCGCCGCCCATCTCTCTCGCCGACGTCGATGACCCGGAGGAGCCGCCACCGCCTCCTCCGGCCCACTCAT
GGAAACTCAAGGGGGTTGTGTCTGTCATTCGCCATGCCGACCGCACGCCGAAGCAGAAGTACAAGTTCACCTTTCATACC
GATCCATTCATCGAGCTCCTCAAGGGCCACCAGGAAGAGGTCCTGTTGATTGGCGATGCAGCTCTGGCAAGTGTAGCCAA
TGCGGTCGATACTGCTATCACGGCTGGAATCGAAGATCGTGGCAAACTTCTGGCCCTACGCAACGTGCTCGTCAAAAAGG
GTTCCTGGCCGGGCACAAAGGTTCAGATCAAGCCCATGTTTCGGAAGAAGAAGACTACCGAGGACACCTCCTTTCCCCCC
CTTGAAGAGCAGATTGCGACAGACGCTGCCACGATAGCCGCTGCCGCAGCCGCTGCTACTGTAGGGACAGTGTCGAGCGA
CCAGAACGCTATCAAGGACGACGAGGTTCCCACGAGACTGCCACCACGGAGGCACGACTCCCTTTCCGGGGTGACCATGT
CCAAGTTCACGGCCGCCGAGAATAGCCTGGTTCTCGACAAGCTCCAGCTGATTGTGAAATGGGGAGGCGAACCCACGCAT
TCGGCCCGCTATCAGGCGCAGGAACTGGGCGAGAATATGCGCAACGACTTCCTGCTGCTCAATCGCGACATTCTCGACGA
CGTCCACGTCTTCAGCAGCTCGGAACGCCGTGTCACTACGAGCGCACAGATCTGGGCGTCTGCTTTTCTGGGCGAGAAGG
ATCTGCCGTCCGACTTTATCACCATCCGCAAAAGTCTCCTGGACGACTCGAATGCCGCCAAGGATGAGATGGACAAGGTG
AAAAAGAAGCTGAAGAACTTGCTGCGCAAAGACAACGAGCGGCCGCCACAGTTTGCCTGGCCCGACAACATGCCGGAACC
GTCAGAGGTGCAGACGCGTGTCGTGCAGTTGATGAACTTCCACCGTCGCGTCTTACAGTACAACTACAGCAAACTGTACG
GCACGAGCAACGGCAGCGCAAGCGCCCCGGGCCTCAGTCCCAGCCTCTCCAAGAGCTCGAGCTTCGAGAAGGCGGGAGCT
GGTGCAGGCACTGCTACACCGGGGACCGACAATAGTACCATCACCACGGAGGGAGCAGCAGGATCAGGCGAGACAAGCGG
CCTTTCGGCTTCCAGCTCGATCGCCCAGGCAAACACGGTTAATGGCATACAGTCCCGCTGGTGCTCTGGCGAAGATGCCG
AACTGTTCCGTGAGCGCTGGGAGAAGCTGTTTGCCGAGTTTTGTGACCTCGAAAAGGTCGACCCCAGCAAGATATCGGAG
CTGTACGACACCATGAAGTTCGACGCCCTGCACAACCGCGCATTTCTCGAGTGGGTCTTCACGCCGCCCAAACACATGCT
CGAGGAGGAGGATTGGGCTGGCGCGCTTGGCAGCAGCGGCAAGCCATCGGGCCACAAGGATACAGTGGCGTCGACATCCC
CGCCGACTGGCCTGCCATCGCTTTCGCCTGTCTCGGCCACGACCTTGACACCGAAAGCCACATTGACGGTCGAAGAGCGC
AGGTCCTTTGAGGATATTCGACTGTCAACAGCCTCCGTTCCGCCAGGCAAGGCCGTGTTCGACGACAAGGACGGCAGCAT
CTTGGACAAGGACCCGCAAGTCAAAGATAGCAGGTCGGACTCGAGCAGCCACCGGGCCTCTGTCAGGCGCATCTTCCGTC
GTCGGTCTTGGATGGCAGGGCTTCGTCATGCGGCAAACGAGCCTCCGCTGGCCGAGCAGTACTTCCACCTCTACAAGGGC
ACCAACAGCCCGACAAAGGCCAAGACCGATGCCCGCTTCGAGCCGCTTCGCGAGCTGTACCAGCTGGCCAAGGTGCTCTT
CGACTTCATCTGCCCCCAGGAATACGGAATCTCGGACAGTGAGAAGTTAGAGATCGGGCTGTTGACGTCGCTGCCGCTAC
TCAAGGAGCTGGTACAAGACCTCGAAGACATGCAGGCGTCCGACGAGGTCAAGTCGTTCTTTTACTTCACCAAGGAGTCC
CACATTTACACGCTGCTCAACTGCATCCTCGAGGGCGGAATCGAGACGAAGATCACGCGAGCCACCATTCCCGAGCTCGA
CTACCTGTCGCAGATCTGTTTCGAGCTCTACGAATCCGAGACGAGCAACCCGGCCGTGAAGAAGGGGCAGCATGAGAAGG
ACGATGGACACGGACACGGCAACGACAGCGACAGTGCCGTAGAAACATCCATCTACCAGTACAGCATCCGCATCACCATC
AGTCCTGGCTGCCACGTCTATGATCCGCTCGATGTGCAGCTTGACAGCCGTCATTGCATCAGCTGTGCACCGCGTCGCAG
CCTGACGGCCCACATTGACTGGAAGACGGTCATTGAGACCTTGCGCAGCCGTTTTCACGAGTAAGCCGGTCCTACCCTTG
TCCCTTGGTCCTGATGCTTCTCACGTGCTGACCAACCAGGGTCAAACTGCCAAAGTCGTTCTTAGCAGTCAACCTGTCGG
ATGCGTTTACCTTCCAGGAGAAACAGGCCAGTGATGGCGAAGGACAGGGGCTGGAAATGAAGCCTCTCGTGAAGGAGAGC
AAGGCAGCAGGCGCCGAAAAGGCCGGCTCGGAAGCTGAAGCCGGTGCCAGTGGAGCTGGTAAGACTGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62