GenePrediction:GLEAN_4089 Details

Name: GLEAN_4089
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2702494..2703557 (+ strand)
Length: 1064
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2702494..2702570 (+ strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_113:2702740..2703335 (+ strand)
Length: 596
Type: CDS
Source: GLEAN
Position: GCSC_113:2703400..2703557 (+ strand)
Length: 158
>GLEAN_4089 class=GenePrediction position=GCSC_113:2702494..2703557 (+ strand)
ATGGCTTTCGACACACCTCTCACTGCGTCATTGAAGCCGTCGGCGACCGACAAGACTAGCTATGGTTTTTGGCTGACGTA
GGTTTTTTCTGTTTCATTCTGGTGCAACTTGTTCTGCCTTTTGTTCTGTTGTTTCTGATTCTATTTCGTTCTCCTCTGCT
CTCTTCTGTTCTTTTTGGTTTCTTCTCTCATTTCCATTTCCTTCTCATCCTCTCCTCTTCTCATCTTCTCCTCCTCACAA
CCCCAGATATCCAACCGCGGCTGTGGCCAAGACCATCCTGCGCTCGGCCTCAACGTCCGGCTCTGGCCGTTTCTCCTGGG
TCCTCGTCGACGCCGAACACGGCCTCATCGCCGACCGCCACTACTACGACCTCACCACAGCCATTGCGGCCGAAGGTGCC
AGCCCCATCATCCGCGTCCCCTGGGCCGAGGAGTGGATGATCAAGCGCGCCCTCGATGCTGGTGCCCATGGTGTGCTGAC
GCCCATGTGCCACACGGCCGCTGATGCCGAGCGCATCGTGCGTTACGTCAAGTATCCGCCGCGAGGCTCGCGTGGCTACG
GACCCATGTTTGCCGTCCACGCTTTCAGTGATGTCGCCGGCGGTGACCACTACGATCTCGACGCCGCCAACAGCATCGTC
GTAGCCGTCCAGATCGAGTCTCGCCAGGGCGTCGACAACGTCGAGGAAATCGCCGCCGTCGACGGCCTCGACATCCTCCT
CATCGGGCCATTTGACCTCGCCCTACAGATGGGCGTCGTCCGTGGCGGCCCCGAGCACGAGGCTGCCATCCAGAAGGTCC
TCCGCGCCGCCAAGGCCAACGGCAAGACCGCCGCCATTTTCTGTGCGTCTGGCTTTCTTTCTCCGCTCATCCCTCGTCCC
CCTCGTCCTCCTCACTTACATCACAGGCTCCAACGGCGCACAAGCCCGCCAGCGGGCCACCGAGGGCTTCGACATGGTAT
CCGTCATCACCGACGTCGGCGCCCTCGGCGAGGTCATGGTCGGACATCTAGGCATCGCCAACGGCACGGCCAAGGAGATA
GCAGCAAAGCACAATGGCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62