GenePrediction:GLEAN_408 Details

Name: GLEAN_408
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1597714..1599555 (+ strand)
Length: 1842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1597714..1597722 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_167:1597787..1599211 (+ strand)
Length: 1425
Type: CDS
Source: GLEAN
Position: GCSC_167:1599272..1599410 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_167:1599467..1599555 (+ strand)
Length: 89
>GLEAN_408 class=GenePrediction position=GCSC_167:1597714..1599555 (+ strand)
ATGCCTCCGGTGAGTCGCGTAAGCACACCCTCCCACTCTCGGCCCTGAAGCAATGGCTGCTGACCCACACCAGGCACGTC
CCGTCAGACAGCGGCTCGTCACCAACGAGAATGACGAGAATGGCGCAGTCGCCGCCCGTATGACGCGTGCAAAGACGGCT
TCGCTTCACACGGAGGATCTCGCCGTCCCCGCCAAGCCCCTCCAAACCAAGCGGTCTGCTCAACCCGCTGCTGCGCAGCC
CGGCCTGCGGAAGCGCGCCGCGCTGGGCGATGTCAGCAATGTCACCAAGACCGACGTGGTCGAGGCTAAGAAGGCCTCCG
GCAAGGTCAGCCTGGTGTCCAAGGCTGCCCAGCCAACCGGAGTACAGAAGGCCACGTCCCGTCCCACCACCCGCACAGCC
CTTGCCACCAAGGAGGCGGCCAAGAAGGCCACCGAGGTCAAGAAGTCCGGCCACGGCGCAATCAGCACCGTCCAGAAGAG
GAAAGCCGCCGCTGCAGCAGCCGCTGCTGCCGCTGCCGTGGTGAAGGAGGAGACGCCAGCCGACGAAGAGCCTGCCCGGA
AGAAGGCCCACACTGCGCCAGCGCGGGCCGAGGAGCCAGTCAAAGCCAAGAAGGAGCCTGTTGTCGAAAAGGTCATCGAG
AAGGCTGTCCAAAAGGCGGCTGCCGAGAAGGCTGCCCAGAAAGCCGCTGCTGCCGAGAAGGCTGCCGAGAAGGCTGCTGA
GAAGGCTGCCGAGAAGGCCGCCCAGAAAGCTGCCGCTGCCGAGAAGGTTGTCCAGAAAGCTGCCCAGAAAGCCATCGTCG
AAAAGGCTCTCCCAGTAGAGGAGCCCGTCGAAAAGTATGAATCGGTCGAATTCGTCTTTCCCGAAGGCGTCAAGGATCTC
GATAGCGAGGACCTGCACGACCCGCAGATGGTGGCCGAATATGCTCCGGAGATCTTCGAGTACCTCTGCGACCTGGAATG
CAGCTCCCTGCCGAACCCTCGCTACATGAACCACCAAGACGAGCTGGACTGGAAGACGCGTGGTGTCCTCATCGACTGGC
TGGTCGAGGTCCACACCCGCTTCCACTTGCTGCCCGAGACGCTCTTCCTCGCCGTCAACATTGTCGACCGGTTCCTCTCG
GCCAAGGTAGTCCAGCTCGACCGCCTGCAGCTGGTCGGCGTTACCGCCATGTTCATTGCCGCAAAGTACGAGGAGGTCCT
CTCGCCTTCGGTCAGCAGCTTCCGGCACGTGGCCGATGATGGATTCAGTGAGGCCGAGATCCTCAGCGCCGAGCGCTTCA
TGCTGGGAACCCTCAACTACGATCTCAGCTACCCGAACCCGATGAACTTTTTGCGCCGTGTCTCGAAAGCGGACAACTAT
GACATCCAAACCCGGACCGTGGCAAAGTATCTGACGGAGATCAGCCTCCTCGATCACCGGTTTATGTCCTACCGACCCAG
CCACGTTGCCGCTGCCGCCATGTTCCTGGCACGATTGATTCTTGACCGGGGTGAATGGGTATGCATGATTCCGTGTCCCC
TCTGTGCTGTGTCATGAGTTTGCTGACACGATATACAGGACGAGACCCTGTCCTTTTACGCAGGCTACAACGAGGAGGAG
ATCGAGCCGGTGGCCATTCTCATGATTGACTACCTGGCTCGACCGTCTACCCACGAGGCATTCTTCAAGAAGTATGCCAG
CAAGAAGTACTTGAAGGGTAAGGCCCCCAATCACCTGCTCTGTTTCCTGCCACAAAGGTCTAACATGTTGCAGCTTCCCT
CATCACTCGCCAGTGGGCAAAGAAGAACGCAACTCACTTCGGCATCACGGATACAGACCTGTCCGTGGACGAGATCTCAT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62