GenePrediction:GLEAN_4090 Details

Name: GLEAN_4090
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2707784..2708651 (+ strand)
Length: 868
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2707784..2708097 (+ strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_113:2708158..2708204 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_113:2708266..2708651 (+ strand)
Length: 386
>GLEAN_4090 class=GenePrediction position=GCSC_113:2707784..2708651 (+ strand)
ATGGAAGCGGGCCGGCTTCCGTTGCTTGCCAAGCACCGCCAGGCTTCGCCTGCTCGTCGCCTTGGAAGCTCCATCTGGGC
CCGTATCACGGCAATCGCGGCCGTGTCGGCGCTCGTCTTCTGGGGGCTCACCCAGGACGGATTCTTCTTCCATGCGGCAC
CGATGCCTCCTGTCTCTGGGAGCAAACTGGTGCCACTGGAGGCACATATTATGAGCAAGTGCCCTGATGCCAGGGACTGC
CTGCACGACCTCATCCTGCCGGCCATGCAGCAGGTCTACGAGAAGACCAACTTTACGCTCTCGTTCATCGGACAGTAGGC
GACCCAAGCTTCTGCTTCTTCCTAGGCAGCAGCAGCACGACTGACCAGTTGCAGGCAAGCAGCCGACGGTGGCGTCGAGT
GCAAACACGGGCCGGCCGAATGTACGTTTTGTTTTGGTCTCCTCTCACCATCGTTACAGAAAGGCTAACCCCCCACCTCC
AGGCATGGGCAACATCATCGAACTGTGTGCCAGCAGGCTCTACCCAGACCCCAAGATCTACCTCGGCTTCACCATGTGCC
TCTTCCGCGACTACCAGGACATCCCGGAGCAGAGCATTGTGGAGGACTGCGCGCTGGAGCACGGCATCGACATTGAGGCG
ATCAACGAATGTGCCACGCTCGATGACGGCGAGCACGGCATGGATCTGCTGCGTCGCAGCATCCGGCATAGCAAGGACGC
CGGAGTGACGTACAGCTGCACGGTGCGGCTGGACGAACAGGTGTACTGCATCCGGGACGACGGCCAGTGGAAGGAATGCC
CGTCGGGCGGTGGGGTGAACGATCTGGTCTTGGCCGTGGAGAAGCTGTGGCGGCAGGCGAATGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62