GenePrediction:GLEAN_4091 Details

Name: GLEAN_4091
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2722559..2723964 (+ strand)
Length: 1406
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2722559..2722945 (+ strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_113:2723128..2723964 (+ strand)
Length: 837
>GLEAN_4091 class=GenePrediction position=GCSC_113:2722559..2723964 (+ strand)
ATGCGTCTTGCTCAGGCCTCCAAGTATGCCCGCAAAGCACTGGCCTTGCTGCCCAGCGATGAGAGCCTGTGGAAGACTCT
TGCAAAAGATATATACACAATCGTACAAGGCAGCGCCAAAGTTGCTGGTTCTGTTTCGACTCTGGATCCTTCCAAGCTCC
TCGAAGGTCTTGAAACCTGGGCGCAACTACCACAGTTGGTACAGTCCATCATAGACGTTGTCGACCGGCTTTCAAGTCTG
AGAGCTGGTTTTAAATCCGTTTTCAACAATGGAAAAGGCGTAAAGAAGCCACCTCGGTGGTACTTTGCACTTCGCTACAC
CGACATGATGCTTCAGAATAACTGCCCCAAGCTACTCAAGTCCCTTCTTAGGATCCGGAACTCAGATGTCAATCAAATGG
ACATTTTCTGTGTGGACTCTGTGTACAGCTGGAACAAGCTGTCGCCTCTAGAGCCTTGTCTTGAGGAATTGAAGTCGTTT
CTGATTGAGAAAGGCAAAGACGCCAATGAAGCTCTTGTCAAAGAATGGGTTGCCTTGTAACGGGTGCTAACCTACCCGAA
AATCCGAAGTCGTCTCCCTTGGGCTGGGGCAGCCGCCAATTTCGCACCACAATTGACATCATAGAAGTTCCAGCCGATGA
AGGTCGAGGCGGCCTTGTGAACAAAGCTTGGATGAGCTGTTCCCAGGCACACATATTCTATGCGGACCATGCAATACAGC
TTCGGTACGAGCACAAGGCTCTGGGCCTGCTCAAAATAAAACGGTTCAATGGAGACAGCTTGCTCATGGACAAGTGCTAT
ATCAACCTGTCTATTGTGCAATCGAGCGATGCGCAGAAGGCAGAGAGCACTGACTTCCCAATTTCAATCTCTAGGCGCTG
GGGTATCAGCGGTGCTCCGGAAGCAGAACAGATGTCGTTGTCCAATATTTTCATAAAAACAAAGAAATCATCATCTGCTG
TCATGCAAAGACAAGGATCTCTGGATCGCAGGCGAATTCTCATTCGTGGACAGGCTGGCGTGGGTAAGAGTACGCTCTGC
AAAAAAATGGTCTACGACTTCATACATGAAGGGATGTGGAATGATGTTATTGACCGCAATATTTGGATCCCGCTGCGAGA
GCTTGAAAGCAATGGGAATGTTCAGCCACAGGTTCAGCAGCTGCTTGGAGTTAAATACTTCAGTGGGGCGCGCGACGGGC
ATATTCTTGCTAAAGCCTTTTTCGAGACATCTCATGCCGACCCAAACAAGACATTTTTCATCCTAGATGGTCTCGACGAG
GTGTACAGCGAAGTTGATGGCAGAAACGAGTTGTTGCTGAAGCTTTTGAACCGACCGCTGGCTATAATAACATCCCGTCC
ATCCGGCATCAAACGAACTCATATTAAAGATATCGATTTGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62