GenePrediction:GLEAN_4092 Details

Name: GLEAN_4092
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2731204..2732501 (+ strand)
Length: 1298
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2731204..2732212 (+ strand)
Length: 1009
Type: CDS
Source: GLEAN
Position: GCSC_113:2732263..2732501 (+ strand)
Length: 239
>GLEAN_4092 class=GenePrediction position=GCSC_113:2731204..2732501 (+ strand)
ATGGTGCTCCTGCACGGAAGCAGCCTGGTTGCCCAGGCGCTTGCGCTGCTGGGTCCGCGGGCCGACAGCCGTGCCTACAC
CGCACAGACGGTCTCGGCTATCAGCACGCTGCAGGGCTGGTACGACGAGGCGGATGGGCTGTGGAACGGCACGGGCTGGT
GGAACAGCGCGAACCTGCTGACGACGCTGGCTGACTTTGCGCTGCTGGACGGCGACGACGCCACGCGGCTGGGCCTCACC
GCCATCATGGCCAACACGTACGCGGCGGCGCAGGGCAGCGGCAGCCAGCAGACGGCCGTCAAGGTGGTCGACAGCACCGG
TCTGGTCCGGTCGTCGTATGTGCGGACGGCCGTGGAGGTGGAAGCGATGCCGGGCAGCAGCAGCAGTCTCGTTGCCGTCC
ACGACACCTTTTCTGGCTTCATCAACAACTTTTACGACGACGAGGGCTGGTGGACGCTGGCGCTCATCCACGCCTTTGAC
GCGACCAACCGGACAGACTATCTGGTCTCGGCCGAGTCCATCTTTGCTGATCTGCATCGTGGCGTCTCGACCGACGTCTG
CGGCGGCGGCATCTGGTGGAGCAAGGACCACACGTACAAGAACGCCATCGCCAACGAGCTCTATCTGGCGGCGGCCGCGT
CGCTTGCCAACCGTGTCGCCGGAGCTGCTGCCCGCGTTAAGTACCGCGACATCGCCGTCGGCCAGTGGGCCTGGTTCCGT
CACAGCGGCATGATCAACGCCCAGGGCACCGTCAACGATGGCCTCGTCATCCACGAAAACGGGTCCTGCTCCAACAACGG
CGCCACCGTGTGGTCCTACAACCAGGGCGTCGTGCTCGGCGGGCTCGTCGAGCTGCATCGCGCCCTTGGCGGCGCCGATT
TGTCGCTGCTGCCGGCAGCCGTGGCCATCGCCAGGGCCGGCATCGACGCCCTGTCCGCCAACGGCATCCTGCACGAGTCG
TGCGAGAGCGGCGGCGGAGACTGCGGCTCGGACGGACCAACATTTAAAGGTGGGCATATTTGTTGTACCAAGGACGTGAG
ATTGTGTACTGACGTCCAGGTGTCTTCCTTCGAAACCTCCACTATCTTTCCCAGGCCGGTCTGTCCAGCCGGGACAGAGA
CTACTTCCGCGCCTACATCCTGCAAAACGCCGACTCTATCTGGCTCAACGACCGCGACACCACTACTAACGAGCTGGGCC
TCGTCTGGTCGGGACCCGTGAGTGCCAACGGTGGCCCAAACACGGCCACGCATGGTTCAGCCGTCGACTGTCTGGTGGCA
GCAGTTGCTGTAGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62