GenePrediction:GLEAN_4093 Details

Name: GLEAN_4093
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2734358..2735490 (+ strand)
Length: 1133
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2734358..2734464 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_113:2734524..2735490 (+ strand)
Length: 967
>GLEAN_4093 class=GenePrediction position=GCSC_113:2734358..2735490 (+ strand)
ATGCCCGCCGCCGCCAAGCCCGAGGAGAAGGGCGAGTCCTCGACGTCGGCAGCAAAGAAGGCGCTGGCTGCTACGTCGAA
TGGAACGCCCAACTACGAGCTGCCCTGGTAGGCGTCCGTTTCCTTGTGCGTGCTGAGCTGGGCCTGTGTCTGACGGGGTG
CTGCAGGGTCGAAAAGTACCGGCCGGCCTTTCTGGACGACATTGTGGGCAACACCGAGACGATTGAGCGGCTCAAGATCA
TCGCCAAGGACGGCAACATGCCGCATATTATCATCTCGGGGATGCCGGGCATCGGCAAGACGACCAGCGTGCTCTGTCTG
GCGCGGCAGCTACTCGGGGACGCGTACAAGGAGGCGGTTCTGGAGCTGAACGCGAGCGATGAGCGCGGCATTGACGTGGT
GCGCAACCGGATCAAGGGCTTCGCGCAGAAGAAGGTGACGCTGCCGGCGGGCCGGCACAAGATCGTCATCCTGGACGAGG
CTGACAGCATGACGTCGGGAGCGCAGCAGGCGCTGCGGCGGACGATGGAGATCTACTCCAATACGACGCGCTTCGCCTTT
GCGTGCAACCAGTCCAACAAGATCATCGAGCCGCTGCAGTCACGCTGCGCGATCCTGCGCTATGCCCGCCTAACGGACGC
CCAGGTCGTCAAGCGGCTGCTGCAGATCATCGAGGCTGAGCAGGTGCGCTACAGCGACGACGGGCTCGCCGCGCTCGTCT
TCAGCGCCGAGGGCGACATGCGCCAGGCCATCAACAACCTGCAGTCCACCCACGCCGGCTTCGGCTTCGTCTCGGGCGAC
AACGTCTTCAAGGTCGTCGATGCCCCCCATCCCATCAAGGTCCAGGCCATGCTCAAGGCCTGCCACGAGGGCAACGTCGA
CGCCGCCCTCGACATCCTGCACGAGCTCTGGCGCCTCGGCTACTCCAGCCACGACATCATCAGCACCATGTTCCGCGTCA
CCAAGACTATGCCCGGCCTCAGCGAACACGCCAAGCTCGAGTTCATCCGTGAGATCGGCTTCACCCACATGAAGATCCTC
GAGGGCGTCCAGACCCTGCTCCAGCTCAGCGGCTGTCTCGCCCGCCTCTGCAAGCTCAACATGGACCCGAAGCTGTTTGC
GGCCTTGTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62