GenePrediction:GLEAN_4095 Details

Name: GLEAN_4095
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2740669..2744153 (+ strand)
Length: 3485
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2740669..2741355 (+ strand)
Length: 687
Type: CDS
Source: GLEAN
Position: GCSC_113:2741812..2742342 (+ strand)
Length: 531
Type: CDS
Source: GLEAN
Position: GCSC_113:2742417..2743090 (+ strand)
Length: 674
Type: CDS
Source: GLEAN
Position: GCSC_113:2743151..2744153 (+ strand)
Length: 1003
>GLEAN_4095 class=GenePrediction position=GCSC_113:2740669..2744153 (+ strand)
ATGAGCGGATCTCTGCCTCCGAGGCAGCACGCCTTCAATGGCCAGCAGCAGATGATGTCGGGTCCAGGCAACGTCGCTGT
GCCCTACGCGCATGGCGTGTCCCACATGCCGCAGCCCGCGGCCGGCCAGTATCCCCAGGCGGGGCCGCTGCCGTCGCTGC
AGTTCTACCAACAGTCCCTGCCTTCTCCCCAGCAGCAGCCACCGCAGATCCAAGGCCACCTCGCAGCTCATCCCTCACAC
TTTTCCCACATGGGCGCCATGCATGCGCAGCAGCATCCTCAGCATCCTCAGCATCAGCAGATCCAGCAGCTCCAGCAGCT
CCAGCAGCATCCTCAACATCAGCAGATCCAGCAGCTCCAGCAGCACCAGCAGCAGCAGCTCCCGCAACTCCCACAACACT
CACCAATACCTCAGCATCTCCAGCAGCCTGGTGCTCCTCAGCGATTCCAGCCGCAACAGACACCACCACAACACTTCATG
CCGTATCCCGTACAGCGGTCCCAGTCGCCCATGATCCCGCAGCCCGGCAGCGCATTTCATTTCCAGCACAATGGCGTGCC
GATGGCTGGCCAGATGGCGTCTCCCGCAGCCATGCCGACTACGCCCAGCCCGGTGCCGGCGCATCTACCGTCTCCCATGC
AATACATCCCGCAACGACAGCCCCAGCGGCTCTCCCAGCCGCAAGTCGTCATACCGACAAAACCTTCAAACATGTATACA
AGCCCATCGCCGACGCCACAGTACCAACACATTCCGCCGCCGCCGCAGCAGCAGCATCAACAGCAGCAGATTCAACAAAT
ACAGCAAATGCAGCAACAGCAGCTACAGCAGCAAAGACAACGGCAGCAGCAGCAACAGCAGCAGCAACAACAGCAGCAGC
AACAGCAGCAGCAGCAACAGCAGCAGCAGCAACAACAGCAGCAGCAACAACAGCAGCAGCAACAACAGCAGCAGCAGCAG
CAACGACAACTACAGCAGCAGCAGCAACATCATCAACAACAACAACAACAACAGCAACAACAAATGCAAATGCAAATGCA
ACACAACCACCGACAGCAGGAGTTTCAGATTATGCCAACTGCCAGCCCTAAAGTCTTTCAACAATCGCCTCGACTATCCA
TGCCTTCCCCGTCTCTCCAACAGCTCTCACAACCAGTAATTCACATACCAGCTATATCCGAGCAGCAGCACTATTCACAA
CAACCCCAAGTTCAGCAACAGCAGCAGCACTACCAACACTACCAACAACCACCGGTAACGCCAAAAACTACTGCCAACTC
CCTACCAAAACCGAGTCCGCGCATCTCGACCAAGGGCGGTGTCCAAAAGCCGCTGAAGACCCCTCGGAAACCCAGCGTTG
GCAGCGTACGCGCGTCGCCCAAACCGGTTCCGAGACGGAGTCCAGCCGACGCCGCGGCCCTTCTCATTTGTGTTGCCGAC
GACTGCCTATCCAAGGCACAGAGCGCGGCTCCCGGACTGGCCAGGTCGCGAGACGAAGGAAAGCTCCGCGGGTACTACAA
GCTCATGGCAACCGGCTTGGGCTGCCTCGACGCGGCTCTACGGAGCGGAAAATTCCCACCACGAGTCGAGGTCAAGATCC
GGATTCGTTACGCCTCCATTCTCAGCGAGGAGACGGAAAATCTCATGCAGGCCGAAACGACCCTGCAGCTGGCTGTTGCG
ACCTGCGAGAAGGCGAGCTTGCCCTGTCCTTGGACTGCTCTTGACATGATGCTAACCGGTTACTGCAGTACCGTCTGGCC
GATCTGAGGCCGTATGTCCAGTTTCTGTTTATGAAAGTTCTGTTTCGGAGGAAACCGAAAGCTGCTCTCATTGCGATCCA
GAGCCATATAGAGGACTGCTCTAGTCGAGGCCATACATACTGGACATACGCCTTCCGCTTTCTCAAGGCGTTTTTCCATT
TTGAAGCCGGCACTCCCGCGGACACACATGCGCTGGAGAACTTGCATGCCATCACCACCCTTGCCGAGCAGCGTGGTGAC
CGCGCCGTCTATGTTCTCGCATCCCTGCTGCAGGCTCTAGCGCTCTTCCGGACGACCGACGGCGATGTTGTGGAGAAGGT
GCACACGTGCATCGCGGCAGCCTCCAAGTACCAGTTGGATGAGTCTGTGCACATCCCACAACTCGATGTTCTGTGGCATC
TGCTAGACCTCTCCTGTAGCTTCTACCAAAAGGAAAAGGCATTGACGGACAAGATGAACATACTGCAGACGCGCCTAGAA
GAACTAAAGGACTCTCCTCTGTGGACATCCGACTCGTCCGAGCTGCTTCTGCCGTTGAAACGAGACGGGACAGGATCAGC
CACCACGATCAGCGAGGACACAGGCGATGTTCTCCGGCCAGGAGAAAAGTGCGATTATCTCGTCCTGGCCAGCTTCAGCA
AGGTCAAGGCTTTCATTCTCGGGTAAGTCTCATGTTGATCCGTTGTCGAGCAGGACGGGTAACTAACCGGCATGCCCTCC
AGCTTCACGTTCAGTGGCCTGACCCTGGCATCCAAACAGCAGCTGAACGACAGAAGGAGCATGGACTACTGGGCCGAGGC
ATTAAAGATGATTGCGCAGAGTAAGTTCCAGGCCAGCGAGTCGGCTTTTGTGATTTTGAGCAGCAGCACTGACAGGCTTC
TGATGACAGGCGCCAACGCCAAACCAGCAACGCCCATATTCCTGCACGAGGCTGCTGACGGGGCCCGCTGGCGGGCCACC
ATGACGTCGTACATTCTCGTGCTCACGGGCCTGAACGCGGCTACGCACTGCGACTGGGTCAAGGTACAGGACTGCACGAT
GGATCTGGACAAGTCGATCAGGGAGGCCGACGACGGCCCTCTGGGCGTGCTGGCACTCTACCTCAAGGGTGTGCTGAGCC
AGGGCACGGGCGAGCTGCAGGAGGCGATGGACACGTTTGAGGACGCGCAGTTCTCGCTCGTGGCGGACGCGCGGCCTTCG
ACCAACGAGGGCCACGTCAAGCAGGAGATTGCGCTGCTGGCGGCCATGAATCGGCTGCTGATCATGCAACTGGACCGACT
GCGGAACGAGCCCAAGATCAACGAGCTGGTCGAGCAGCTGAAGCACCTGTGTGCGAGCCACACGAACCCTGAGATCCGCA
CGGCTTACAGCCTCGTCATGGCGGCCATCAACACGCAGCCGCCACTGTCGATGCACGACATCAAGATGCACATCCAGCAG
GGCCTCAATGGGTCGACCACCAGCAGCAACGCCCAGTGCCTCAACATTGCCCTCAACACGATGCGCTACCGGCTTTTTGA
GAACGTCGTGGGCGACCAGGCGCTCAAGAGCGCCAAGGCCGGGTCGACGCAAGCCAAGAAGAGCGGCAACATCCTGTGGA
TGAGCGTGGCCGACGGCATGCTCGCAGACACGTACGAGGTCCAAGGCCAGACGGCCCAGGCCCAGATCTCACGCCAGTCC
GGTATCCAGTATGCCAACGACTCCTGGGAGAGCACTCAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62