GenePrediction:GLEAN_409 Details

Name: GLEAN_409
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1611151..1613917 (+ strand)
Length: 2767
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1611151..1611324 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_167:1611411..1611505 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_167:1611573..1611693 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_167:1611754..1611861 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_167:1611944..1613917 (+ strand)
Length: 1974
>GLEAN_409 class=GenePrediction position=GCSC_167:1611151..1613917 (+ strand)
ATGGTGTCCGTCAGGAAGCGGCTTCTCGACGACAGAGGCCCGGCTGCCGCTGCCGACGCGCCCCGGCCATCTCCGGAACT
GCGTCGCCTCCGAAACATGTGGCAGTTTGCCTGTCTCTGCCAGTGGCTCTACATCTTCGGCCCGGTCATCAAGCTGGACG
CCCCGGATATCGATGTGAGTGCTCTGTGCACCACTGCCTCCTGTCGAGGTCTTACGGCTTCGACCATGCTATTTGGTGCT
GACAGGCCTTGGGAATCTAGGAGCTGGAAGCTCAGTGTCTGAGCCCGCATTCGACTACTCTGCAGGAGATCGGGCTGGCA
ATGCTCAAATATCTGTCTTCGCATCGCGGTCTCACGTACGTATAATCCTGTGTCGTCACCCCTTGGGAGCCATATTGGCT
GTCACGTGCTCATCATCGACAGAGCCGACCTGTTTGACGAGTACACGCGGCGACAATACGTGGCCAAGGCGCCCGAACTG
CCAAACCCCTTCGGGACCGATGAAATCCCGGACAAGTTCTCTGGGTTTGATGCCTTCAAAAAGGTCAGCTCCCGCCCCTC
CTTAGCCCAGAGCCGTCACGTGGTTGCTGACGCCGTGCTCTAGGTTCGCGTCCTGCACCAGATGACACAGTTTATCATGA
TGAATTCCGAAAAGCTGCGAGAGAAGATGGCGGAGCAGAAAGACGTCGTCGACCAGGACCAGACATCATGGGTGAGTCGC
CATGCCTCGCCAACGGCGTGCAGGTCCAGGATGGTTTCGCAGACGTATACTGACATGCAGGTGGGGTGCGCAGCGCATTG
AGCCATTCGGATGGGACAGCAACGATGACACATACTTTGTTCTCGACGACAACCGGGTGTACCGCTTAAAAGAGCTGCCG
CCCGCGCCACCGAGGCCCAAGAAGAACACCAAGAAGGCCAGGGCTCAGGCAAGGCGAGCCAGCAAGAGACGGCGTGTTTC
TACGGCCACGTCCAGCAATGACATGGAAGATGAGGCGGAGGACACCGTCGTAGAGGCCGAGGCAGAGCCAGAGCTAAAAG
AGAACGATGAAGCGGGCGACGACGGGCTTGGAGGCATGAAGTGGGAGTGCGTCGCCGTGTCTCTGGACGAAATACGGCAG
CTACTCGGCACGATCCCTGGCAGAAAGGACGCGAACGAAAAGATCTTACATAGTAAAATTGTCGACCACCTGTTGCCCAT
CATCGAGCAGCAAGAGGAAAAGCGCAGGAAGCGCGATAAGGAGCGCGAAAAGGAGCTGCTCAACATGGCGAAGCTGGCCC
AGGCGAAGAGATCGAGCCGTATCGCCGGCCGACAAGAGCAGATCAAGCAGGAGGAGCTGCAGCGCGAGGAAGAGACCAAG
CGGCGCCACGACGAAGAGGTGCGGCGGAAGGAGGAGCAGAAGCTGCGCAAGCTGGAGAGAGACCGGGATAATAGGCTTAT
GTCGAGGGAGAACCGGCTGCGAGAGCGGGAGCTGCGCCGGCTGCAGCACCAGGAAGAGCTGTCGCAGCTTTCGGAGGACA
GCAAGAGCGTCAGCAGTGCAGGCGGACCTGGGCGCATCTCTGAGCGGCAGCGCGCAGCCGAGATTGAGAAGACCCGAGAG
GCACTGCGCGAGCTCGAGCAGGAGGAAGACGAGGAGTGGGTGTTCGACTGCGTCTGCGGCCTGCACGGCAAGGTGGACGA
CGGCCAGCACAGCGTGTCGTGCGAGCGGTGCAACATCTGGCAGCACAGCCGGTGTCTGGGCATCAACGAGGAGGAGGCAG
AGAAAGACGACTTCCACTTTGTCTGCTCATCCTGTCGCCGGCGGTCACGTGAGGCCGAGACGGGAGTGCGGTCGCCCATT
GTCAAGATCAAGGTCAACAGGCCGGCAGTGGCGAGCAACAGCGCCAACGGAACGGCTGTCCCGCAGCCGGTTGTCCGCTC
AGCGCTGGAGCCTCCGAGAGAAGGCGTCAACTCGGGCATTCCGGTCAAGATCGACGCGGCACCACAGGCGCTGACCTCAG
CCAGCAGCAACATTGGAGCCGATCCGGTCCTGAAGCCGGCAGAGACGTCCAACGGGATCCACAACCCCTTCTCGTCGCCG
CATCCCGAGCTGTCCCCACCAGGGCTGTCGCCTCGCAAGTCCCATGCATACGACACGATTTACGAGCAGGCCAGCCCTAC
GCCGGTTGGGCTGATGCGCAAGTTTGGCGACCACTCGCTCTCGCCGAACATTGCCATCCGTGCGCCGGCTCTTCTTCTGC
GTCCGACCAACGAAAAGACGGCCGGAGGACCGCCTGCCTCGCCCACCAAGCCCAGGGCTGAAGGCCCTGCCGGAGAGTCG
TCCGGATCGTCCCAGCCGTCCGCTCAGACCGTACTTTTCCCGCCGCCTACGCCCTCCTCGGCCTCCTCGACCCGGGTCAA
GAACGAGCTGTCCGGGCAACAGCAGCAGCAGCAACGGACGCCTTCGGTGGTCATGACACCACGCCTGCACCATCCGCAAA
GAGACGACCCGGGCAGCGGACAGCGGGCCCGGACGTTGTCACCGCTGCTGCCGTCTCACGGGGGCTTGTCCCCGACAAAG
CAGTCGCCCTCGGTTGCGAATGACTTCAGCGCAAGCTTTCCCAGCTCGAGCCCGACTCCGCCCATCTTCCCTCCAGCTGC
AGCGCTGTCGCCTTCTGCGCCAAAGCAGGACCCCACGCCGCCCATCAAGTCGGGAAGCTTTGGGTACCGACAGGTGTCAG
GCGGGCCGCCCTCTGACAGGAAATCATCGCCTGCTGCGAGAGAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62