GenePrediction:GLEAN_40 Details

Name: GLEAN_40
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:287241..291555 (+ strand)
Length: 4315
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:287241..288026 (+ strand)
Length: 786
Type: CDS
Source: GLEAN
Position: GCSC_179:288156..290352 (+ strand)
Length: 2197
Type: CDS
Source: GLEAN
Position: GCSC_179:290465..291555 (+ strand)
Length: 1091
>GLEAN_40 class=GenePrediction position=GCSC_179:287241..291555 (+ strand)
ATGAGCGGAACGCCTCGCGTGCGCTCTGGCGCATTTCCACAAACGCCGGCCACCGTGCGGATGGGCGGTCGTGGTGCCCC
CATGACCCCCTCGCCGAGTCCGCCTACGCCGGCCGGCGAGAAAAAACCCATCTTTGTCTCTGGCCGGCCATCGACGGCCG
GCCGGCGGAGCATGAGCAGCAGCGGCCGTCGTAGCCGCCGCAGCAGCATGGATGGCATCGATGACTACGACGGCTACGAC
AGCTTCGGCCGCTTTGGTGGCGGCAGCCGAAGAAACAGCAGCTTTGGCCGCTTTGGTGGCGGCAGCCGAAGAAACAGCAG
CTTTGGCGCCTCGCCTCCTCGAAATGGTCCCGTCATCCCGCTTGACATCATCGACGCGCCGACACAGCGGTTCTATGCCC
TCGCCTTTTACGTCGGCCTGCTCGCCTGGAAGGGCTACGACTGGGTGCAGCTGCTCGAGGACAACAGCGGGTCCTTCTGG
CTCTTCCTCAAGTGGATCTGCATCGATTTTGTGCTGCTCTTCGGCCTGCCCGAACTGCGCATTCCCTGGCTCGAGCTTTC
GCAGCCGGTCGTGGTCGTCCTCTTCCTCGGCCACGTCGTGCTCGACTACGTCCTCATGTTCAACATCGGCGTGCCCTGGC
ATGCCTGGGCCCTCGGCCTGATCAAGGTCTTTTACGACCGCGAGCTGTCCATCTCGGAACACTACGTCAAGACGTCCAGC
ATCCTGCAGAACTCGTCGCTCATCTCTGGCCGCCAGATCATCAACATCCTTCCCGAGGGCTCAGCCGTGCTCAATCCCAG
CGGCCTGCCCTTCTGCATCGACCTGTCGTCATCGTCATCGTCATCGTCGTCGTCGTCGTCCGGATCCACCACTGCCGCCC
TGCCGCTCTACTTCAACGCCACCATCCCGGCCGAGGTCGAGCTCGTGCGCCGCGACCTGGACACGAACGAAGAAGAGGTC
CTCAAGCTTAGCCGCCACCAGCTGCGCGAGATCGCCAAGCTGGTCCGCCGCCACGAGCAGGCCCAGTCGGACGGCAGTGC
CACCACGGCCGTGCGCTACGACGTGCCCGTCAAGAAGCCCGGTGCCTACCGGCTCGGCCGCGTGCTCGACGAGTACAAGC
TGGACGTGCAGCGACCCAGCCCCTTCTCGTTTGTCGTTGCCTGTCCCAGCGCCCAGGTGGGCCGCAGCAGCAGCAGCAGC
GGTGGTGGTGGTGGCACGTCCGGCGTCTCGCTCAAGAAACAGTCGTCGTGGTCGTCGTCACTGACAGCGGCGTCATCAGC
AGGTCCTGTCACGCGCTGCCACGGCGACCTGTCGAACCTCCTGCTCGAGGTGCACGGCACGCCCCCGCTCAAGATCGTGT
ACAGCCGCACCATCAACGGCAAGGACCACAGCTTCCACTTTCAGAGCCTCCAGCCCGAGGGCTTCTCGTCGCCTCTCCTC
GGCACAGGCGGCGGTGTTCCCTCGCGCTCGTCATCGTCCTCATCGTCATCGTCATCGTCGCTGGACTTGTTGGATTTTGA
GCTGGCAGCCGTCACGGCCAACATCCCGACAGAGGGTGACGTGGACATCTCGTGGGCACGGGCACGACGTGTGTCGGTCG
GACTCAACGAGACGATGCACGTGGGCGGCGAGTGGCAGTACTCGATCGACGAAGTGCACGACGCGTTCGGCAACGTGGCC
AAGTACAACGAGGCGGCAGACGAGCAGCACGACGTGCGGCCGCGGCCATCCAAGCACCAGCTGGCCCAGAGCTTCCTCGT
GCGCGAGCGGCCACGGGCCCGTCTGCAGGGCTGCGACCTACGGCAGCCGCTCAAGGTGGCGCGTGGCCGGTCGACCAGCC
TGCCGGTGCAGTACGACATGCCGGGCGTGCGGCAGGCGGACGACGGGACAGAACACACGCTGACGTGGCAATTTTCGCCC
ATCGATTCGCTGACCAAGAGCGGCGACCACGGCGACGGCGTGGTCACGCAGACGTATAGCGCGCGCCACGCAGACGACCT
GCCGACGATCTCGGCACCGGGCCTGTACACGCTGCGGTCGGTGTCATCGGACGCGTGCCAGGGCGAGGTGCAGGAGCCGT
CGTCGTGTCTGCTGCTCAACCCGCTGGAGCCGAAGCTGGCGCTGCGGTCCGAGGGCATCCCCGACAGCTGCGGTGGGCAG
TCGGTGGGCCTGCGGGTCGACCTCGACCTGGTGGGCACGCCGCCGTTCCTGGTGCGCTACGACGTCAGCACCAACGGGGT
GGTACGACACGAGAAGGTGCAGATTGCCAACATGCGGTACCAGCTGGAGCTGATCCCGCGCGTGGCCGGCAGCCACCGGT
ACGTGTTTCGGTCGATCGACGACGCGGTATACAAGGCGCAGCCGCTAGTAGGCGCGGACATGGTGCTGGAGCAGAACGTG
AAGCCGGCGGCGCGAGCGACGATCGACCATCCGACCGGACGGGCGAGCGCGTGTCTGCAGGAGGCGGTGGTCGCGGACGT
GGTACTGTCGGGCGAGGCGCCGTTTGTGCTCGAGTACGTGCTGCTGCACGAAGGCAAGCGACGGGCGTTCAAGGCGGAGC
ACATCACGACGTCGCGGTTCCGGATCGAGACGCCCGCACTGACGGAAGGCGGCGAGTACACGCTGGCGCTGACGAGCGTG
CACGACCGCAGCGGGTGTCGGACCTTTCTGCAGGACTCGGGCGGCGAGCTGAAGATCGCGGTGCGGCGCCAGCGGCCGCG
GGCGGCCTTTGGTCTGATCGAGAACCGGCGTCGCGTGCAGGTGGTCGAGGGCGCGCCGGTGAAGCTGCCGATGCGGCTGA
CGGGCGAAGGTCCGTGGCGGGTGTCGTTTCGGAAGGTGGTCGAGGGCAGCGAGGTGCAGACGCGCTCGCTCGCCTCGGGC
AACGACTTTCTCTCGATTGGCGAGCGTGGTCAGTACGAGATCGTCGACGTGTTCGACAACCAGTGCCACGGCATCGTCGA
TCCAGCCGCGGCGCGGTTTGAGGTCGGCTGGTTCCCGCGGCCGGAGCTGTCGGTGGTGCCGACCGATGCGATCCGACAGC
AGCCAGATGGGCTGCTGGTGAAGCAGGACGTGTGCGAGGGAGACATTGACGGGTTTGAGATTGATTTGAAGGGTGAGTTG
GCGATTCTTTGGGTTGCCTTGTATGTCCTTCTGTCCTTCTGTCTGCTAACAGCATAGGCTCCCCCCCCCCTACCATGTCG
AGTATGATGTCCGCCACAAGGCAGCCTCGGGTTCACAGTCGTCGCTCATTCACAAGCAGTTCGACGCCGCTCTCGGACGG
GCATCACTGCAGATGGACACGGCCAAGGCCGGCACATATCGATACGAGTTCGCACCACCGGCCGACAGCCTGTACAACGG
CGGCAGCGGCGGCAAGAGCGTGCGGACAGACGCGCTGGTGCTGCAGCAGACGGTGCACGCCAAGCCGGCAGCAGTATTTG
CCAAAGCCGGACAGTCGTTCAAGTACTGCATGGCCGAAGAGGACAACGAGGAGCGGATCCCGATGGTACTGACGGGCGTG
GCGCCGTTCTATGTCGAGATCGAGATCAAGCACCAGAGCGGCGTGGTGGCCGAGACGTACGGCGTGCCGTCGATCATGAC
ACACACATACGGATTGCAGATCCCACGGCAACATCTTCGCCCGGGGACGCAGCAGATCCGAATCCGTCGGGTGCGCGATG
CGCGGGGCTGCCAGCAGAAGACGGACGAGGTAGCGGCAGCAGTGGCGGCGACAGCGGCGGCGACAACAGTGCAAGTGCAG
CTGTTTGAGGCGCCGGCAGTCTATGCGCTCGAGTCGCGGACGGACTACTGCGTGGGCGAGCGGATCAGCTACACGCTCTC
GGGCACGGCGCCATTTGACGTGTGGTACACGTTTGACGGGACGGCGCGGCGGGGCAGCTCGGCGTCGACAACGTTCCGGC
GGGTAGCCGAAGCGCCGGGCGAGTTTGCCATCACGGCCGTGGGCGACGGGGCGTCGACCTGTCGGGCATCTGTCAATCTG
ACGCGCACGATCCATCCACTGCCGTGGGTGCGCGTGTCGCAGGGCCGGACGGCACGGTCGGACATCCACGAAGGCGGCGC
GGTCGAGATGGTCTTTGACTTTGGTGGCACGCCGCCCTTTGAGTTCTCGTACACGCGCAGCACGAACGCACGCAAGGGCC
AGCGCAGCCAGGTGCTGGAGACCCGACACGACGTCTCGTACGAGCATCGCAAGGTGGTGCGGGCCAGCCAGGAGGGCACG
TACGAGGTGGTGGCAGTCAAGGACAAGTTCTGTGCCTTTTCGACGCAGCGGCAGGAGGAGGTCGTGAGGGGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62