GenePrediction:GLEAN_4100 Details

Name: GLEAN_4100
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2791869..2794220 (+ strand)
Length: 2352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2791869..2792758 (+ strand)
Length: 890
Type: CDS
Source: GLEAN
Position: GCSC_113:2792823..2793185 (+ strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_113:2793263..2794220 (+ strand)
Length: 958
>GLEAN_4100 class=GenePrediction position=GCSC_113:2791869..2794220 (+ strand)
ATGGCAGAGCTGAAGGAGCCAGCACACAACGGTCTCTGGCCCAACTATGGAAGTCCGGTGCAAATGCCCATTGGCCGCTT
TAGCCACCCTTCTACCCTCGATCCAGTGCTCGCCAATGCTGCCGGCGCCCATCAAGGACCGTCACCGCACTCGGCGCGGC
CTAGGGCCGATGGCAACTCGTACCCATACGCTCGCTACTCACAAGACGAGACGGACGTCTACGGTAGACCGCATCCTGCG
GCTCCCACCGGGGCACCGCATTCGGCACTGGCCGCGCACCACAGCTATCCCAACCTTAAGCGGACATACTCACAAACTGA
ACAGCAGCAGCCGCCACCTCCGTATACGGAGATGGTCCAGGACATGCGGGATGATGGCTCGAAATTAAACGTCAACCAGG
GCCACAAGCTGCTGTCTTTCAAGAGAGTCCCGGACAAGCACACCCTTGTCGACCATCACGGTCGCGTGCAGCAGTTGGAT
CTGAACGCTCAGCTCCATGGAATGTTCTTCCTTTCTGAGATGCCCGCGAGCACGAGCGATGGCACCGTGTTGCAGCCGGA
GCTGACATGCTACCGCCGCAATCTGTTCCAGATCAGCGGGACCCTCATCACTCCACGAGGCCTGCTCTCTGTCGTGACCG
ATGGCGGCGACCCCGTGGCAGTGAGTACTACCGAGCTCACAATTTCGGCCATTGAGTCCGTTGACGGCCACCCGGTGCGC
CTCATTGTCATTCCGTGGAAGACGCCACCACCAAACTCTCCAGAAATCAGCCAAAGTCCCGACCAGGAGCCTGCGCCCTT
GCCTCTGATTCCGTTCCAGGACGATGGATCAGAAAGCGATGGCGAGTATGCCGTGTATCCCATAGGATGGCGCCGTCTGC
AGTTCCGGATGTAAGTTGCACCTTCTCCACAGGCAGGAAGTATGAGATTGCTAACCAGGCCTTCCCGATATTAGAGCGAC
GGCAAACAATGGACGGCGGAAGGAGCTGCAGCAACACTTTGTGCTGCACTTGAAGGCCATCGGCACCTTGGCCAACGGAT
CCAAAGTAGTTCTGGCCGAGTCTTCGACAGCGCCTGTTGTTGTCCGGGGCAGAAGTCCACGGAACTTCCAGGCCAGGAAA
GAGATTCCTCTGCTTGGGTCGAGTGCGGGATCAAGGGGACAGGCTCTTGTAGAAACTGGGCTAGGAATCGTTGCGGGGCC
ACTCGCTGTCAAACCGCACGATAAGAACCGACCGGTGGCGATGGAGATGCCTCGCTCCTCTTTCACCTTTTCTGCAGGGC
CGAAAATGCCGCCCAGTCCACTATCGATGCGGTCAAAGTAAGTGCAGCATTTTCTGGAGGTGCTAGGTGCCAGGTGCCGA
TGGAGAGAAGCGGTTTTGCTGACAGTCGGTGTAGCTCATACCCGGCCTGGAATCCTTCACAAATGCAGCTTCCTCCCACC
AGCAACGGAAGCTACCCTACAACGACCATGTCGGCCGAGCCGTACCAGAAAATGCCAGTATCTGGTTCACCACAATACAC
CGCAGAGCCACAGGAGATGCCGATGCAGCAGTCGTCGATGCCGTCGGTGCAGCTGTCTCTCGTGGGAAGCGACGGGCAGC
AGTCGAATGCCATCCGGACACAGTATGCGTATGTGCAGGGGTCTTCCGCACCGCCACCACAGCTCTCGCTGCCAACGTCG
GCCGACAACAACCTCAGCGTCCCGAGATACGTCAGCACGAACCCACGGCCGACGAAGAGTCCGCGGCATACAAACCACGA
CTCTGTGCATAGCTCGGGGTCCATGGGCGCCAACGACACATCCAACGAGTACCGATATGGTCCGCCGTCGTATGTCGGCG
TAGGCGGTGATTTGGCGCAACACCAGCAGCACCAGTCATCTCATGCGCACGGGCATCAGCATCCGTCACAGTCGCCACAA
CAGCCGCAGCAGCAGTCATTACGATCGCATCAGCAGCTGGGACCATTGCCGCCATCACAGCACCAGTCACCATCACAACC
CCTTCCACCTCCACAGCCGCACCCTCAGCACCAGCAGCATCAGCAGCACCAGCACAGCCAGTCTGCTTATGGCGCGCAAG
ATACAGCGAACCACAGCCCCAACCCGCCAACTTCGTCGGCATCACAGCCGCCTGCCCGGGACTATTTCCCACCGTCAGCA
TCTTGGACATCAACAGCAGGTGAGGCGAATACGCCTGCGTATGCAAACGGCGATCCTCGACCGTACTCGTTCCCCGACCA
GTACAAGACCGGCCACAACGTCAAGACCGAAGCTTTGCCACAACCGCACGGCTATGGCGGCCCGAGAGGCTCCTTCGACG
CCATGAACCACTACTCGTGGGGGGCGACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62