GenePrediction:GLEAN_4103 Details

Name: GLEAN_4103
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2802042..2802921 (+ strand)
Length: 880
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2802042..2802552 (+ strand)
Length: 511
Type: CDS
Source: GLEAN
Position: GCSC_113:2802614..2802921 (+ strand)
Length: 308
>GLEAN_4103 class=GenePrediction position=GCSC_113:2802042..2802921 (+ strand)
ATGGCTGCTCGACCTCCCCTCTTCACCCGGGGCCTGTCCTCTCTCTCCCAGAGCACGACCGACCCCAACTCGCCCGCCGC
CGGGACGGCCTCCGAGCAGCGTGACGACGCCAAGCGGAACTTCCTCAAGACTATGCGCCCGTTGCCGACGCAGCACTACT
GGAACGTCTTCTTCGACCGGCCGGCCGCCAAGACCGCCGACGAAGCCCAGGCCAAGAAGGCTGTCGACGGCACCAGCCCC
AACTACACGGCTCACCTCGAGCAGCTCGGCACGCAGATCGAGTCGGTCCAGGACTTTTGGCGCTACAACAACAACACGCC
CGTCGATCAGATCAAGATGCGCGAGTCCATCTATCTCTTCAAGGCCGGTTTCCGCCCCGTCTGGGAGGACCGCCGCAACA
TCCACGGCGGCAGCTGGACCTTTCGCGTGCCCAAGAGCATCGGCCCTGACGTCTGGACCCGCGTCCAGCTGTTGGCGATC
GGCGAGAAGCTGCAGAGCGTCTTGGACGAGGGTAGGCATATGCACCATCGTGTAGCCGTGGCCGAGACATGCAGACATGC
TGACATCCACAGGGGACACAATTTGCGGCGTCGGCCTGTCGGTCCGCTTCAACTCACACCTCATCTCCATCTGGCATCGT
GAGGCATCCAAGAAGAAGTCTGTCGACGCCCTGCTGGCCTGTGTGCTCGACGAGCTTCCCGCCGAGCTGCAGCCCAAGCC
CGACAACTACTTCTACAAGAAGCACTCGGAGCACACCGGCTTCAAGGCCCCGCCCGAGCTGCAGGCCGTCCTGGACTCGC
AGAAACGGCGTGACGAGGCCGAGGCGAAGGCGGCCGCAGAAGCGGCGACCGCAGACACCACGGAAACGGCTGCTGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62