GenePrediction:GLEAN_4104 Details

Name: GLEAN_4104
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2804247..2806104 (+ strand)
Length: 1858
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2804247..2804461 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_113:2804568..2804655 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_113:2804726..2805914 (+ strand)
Length: 1189
Type: CDS
Source: GLEAN
Position: GCSC_113:2805977..2806104 (+ strand)
Length: 128
>GLEAN_4104 class=GenePrediction position=GCSC_113:2804247..2806104 (+ strand)
ATGCACCAGCCACACGTCCTTTCCCCACCATCCCCTCCAATTACTCTACGCGTCAACGACGCGCCCTTTGTCAATGCTCG
CCAACGAGCCCCTCCAACTAGACAGCTGCAGCATTTGATTCTGGAGGCCGGCAGCACAACGACCATGTCCCGTGCAAGCG
TCTCGCTCGCGCATCGGCCGCTCTCCACGACCGAGGAGCTGGAGAAGCTGGAACAGTCCATCACGCTCACCCTGCAGGGC
GAGTTTGCTATTTGCCTTCGCAAGCGAGTCAATGGGGCTACTTTGGCTGACTATGGTCCCAGAAATCGATCGCAACTTCA
GCCGAGCCCATCGCATCGTGATCACGAGCATCCTCCCGGTCGTGGAGCAATACGGCGAGCAATGTCGGGCAGTCTGGGAC
TCGTCCAAGGTGAGAGACAGCTGACCGTCTGGTTCCGAGTGACTGGCCCAGCTGACGAGTTTTGCCGGATGCATTGTAGT
TCTGGAAGCAGTTCTTCGAGGCTGCTGCCAATGTCTCTCTGTCAGGGTACGAGGAGCTTGCGGCCAACGACGAGAGCACT
ACGGCCGCCGAGGAGACCACCACGGCCACGCACGAAGACGAAGACGACGAGACCTCGACCGACTACACGCCCCGCCAGCA
GCAGCAGCAGGGCGAAGACTGCGGAGACGACCGCACCAACACGCGGGACGAGTCGCTGCTGTCGGACGGCGACGGCGACC
TGACGGGCAGCACGCCGCGACCGTCCACGTCCAAGTCGAAGCGGCCCCGCTTTTCCGACATGCGGTCACCGTATGAGGTG
CTACGAGAGGAGCTCAATCTGGGCAAGGGGGGTACGGCAGCAGCAGCAGCAGCAGCACAGTCAGCGCCAAAGGGTCCTGT
AGACGACGAAGACGACGACAGCAGCATCATGATGCTCGTGGATGCGAGCCGTACCCGTGCGACCAATCATGACGGCAACA
GCGACGACGACGACAACTCGTCGGCTGCTGACTCAGCACTGCTCGCCGAGCGGACGGCCCGGTTGCCGGACATGTCGATG
ACACCGCGGCTGTCGCTGGACGAGCGCCACCGCCGCGCAGCCGAGGAGGACCTGGCGATGGAGCAGCAGCAGAAGAACCC
GCTGCTGCACCGCGTCATGGACAAGACGTACCGCATCCAGGCAACGCCACACAAGACGATACAGACGGCGCGCAGCGGCA
CCTCGCCGATGCGACTCAAGGTGACGGAACAGCAGCAGCAGCAGCAGCAGGCGCAGGCACATAAGAGGGCCGCATGGCAG
GACTCGTCGCCCATGTCGTCGCCCGAGATGGCCGTGCCCAAGCTGCGCAGTGCCGCCTTTCTGTCGCCCGTTCGGGCCGC
ATACCGGAGCAAGCTGACGGCGGCGGCGGCCGGCCCGCGGACTCCTGGAGTCAGCGTCCAGACGCCGGCGATGAAGAGCA
GGACCAGAGACATCTCGTTTGACGACCTCGGCGTCGATGTCGACGCCGCGCCAGCGGCCGTGCCCTATGGCGGCGCGTCT
GCTGCAGCTGCTTCGGCGGCCGGCCACAAACGAGACGAGATCACGTGGGAAAGTAGCGATGATGACGGCGACGATCTCTA
CGGCGGCTTCAGCCCACCCAAGACCATCAGCTTTGCCCTGCCGCCGTCCAAGCTGCTGCAGACGCCAGGTAAGATACACT
GTTTCTCCGTTTCACGAAGAGCACCAGGTTGCTGACTAATCTCGTTGCAGCACGCGAGGCAAGCAAGCGCATTGTCGAGG
ACATTCTGTACACGGCGGGCGACGACACGGACAATCCGTCCGAATATAGCCCGACGATGGTCAAGATGAATGCCAACATC
CTGGACGAGACGTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62