GenePrediction:GLEAN_4105 Details

Name: GLEAN_4105
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2808713..2810576 (+ strand)
Length: 1864
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2808713..2808878 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_113:2808941..2809091 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_113:2809170..2810137 (+ strand)
Length: 968
Type: CDS
Source: GLEAN
Position: GCSC_113:2810203..2810486 (+ strand)
Length: 284
Type: CDS
Source: GLEAN
Position: GCSC_113:2810541..2810576 (+ strand)
Length: 36
>GLEAN_4105 class=GenePrediction position=GCSC_113:2808713..2810576 (+ strand)
ATGGCAACGATCAACGGAACGGTCGTCGCGTCGCCCTTGGCCACGGCCAAGTACGTTGCCGGCGTCTTTCCTGCCCAATT
CGAGCCGCTTATCGAGGCTGTCGCGCAGACCAGCGTGTGGACGGTCCTGTTCACTGTGCTGGCCATTGCCGTAGTCTACG
ACCAAGGTTAGCCTCAATACATGATCTTCCTCTTCTTCAGCTGCTGATGCATTTTTTGCTTGCCATAGTCAGCTACCTTT
CGCAGAAGGGCAGCATTGTTGGCCCGGCATGGAAGGAGCCGTTTATCGGTCCCTTCTTGCAGAGCGTCAACCCCAAGTTT
GAGGAGTATTATGGCAAGTGGGTGAGCGGCCCATTGAGCTGCGTTTCGGTGTTCCACAAGTATGTTGCGTCCCTGCTGTT
CCACATCGTGCTCATTTTTCAATTGCATCCATACAGCGGCTGACCCGCGCGCTCCAGGTTTGTGGTCATCGCCTCGACCC
GCGACATGGCCCGCAAGGTGTTCAACTCTCCGACCTATGTCAAGCCCTGTGTCGTCGACATTGCCCACAAGCTGCTGGGT
GCCGACAACTGGGTATTTCTCGACGGCAAGGCCCATGTGGACTTCCGCAAGGGCTTGAATGGCCTCTTCACCCGCCGGGC
TCTCGAGTGCTACCTGCCCGGCCAGGAGGATGTGTACCACACCTACTTTAAGCGGTTCGTGAAGATCACCAAGGATGCTG
GCGGCAAGCCTGTCCCGTTCATGAGCGAGTTCCGCGAAATCATGTGCGCCCTGTCGTGCCGCTCGTTTGTCGGCAGCTAT
CTGCCAGAGGAGTCCTTCAAAAGAATCGCCGACGACTACTACCTCATCACGGCTGCCCTCGAGCTGGTCAACTTTCCTAT
TATCCTGCCCTACACCAAGACCTGGTACGGCAAGAAGGCTGCCGATCTGGTCCTGGAAGAGTTCTCCAAGTGCGCGGCTA
AGAGCAAGATCCGCATGCGTGCCGGCGGCGAGGTCAACTCCATCATGGACGCCTGGGTCAAGGCTATGGTCGACTCGGAA
AACTGGCGCAACGCCGAGGCCAAGGGTCTGTCTATCGAGGGCCTCGAGAAGCCGACACCGCTCCTGCGCGAATTCAGCGA
CTATGAGATTGCCCAGACCATCTTCACCTTCCTGTTCGCCTCCCAGGACGCCACCAGCAGCGCTTGCACTTGGCTCTTTC
AGATCATGGCCCAGCGGCCCGATGTCCTCGACCGTGTCCGCGATGAGAACATACGTGTGCGCAAGGGTGACCGCAACGCT
TCCGTCAACCTAGATGAGCTTGAGTCCATGACCTACACCCGTGCCGTCGTACGCGAGCTGCTCCGCTATCGGCCTCCTGT
CCTGATGGTTCCTTACCTCGTCAAGAAGAAGTTCCCCATCTCCGAGACGTACTCTGTCCCTAAAGGTGAGTCTCCCGTCT
TATCCCGGGCTGCATCCTGTATTCGTACGCTTTGCTGACTCTGTTTCTAGGCGCCATGGTCATTCCCACGACGTACATGG
CTCTGCGCGACCCCGATGTGTACACCAACCCGGACGAGTTTGACCCGGAGCGCTACTACACCGGTGACGCGGAGGAGAAG
GGAGCCAAGAACTACCTCGTTTTTGGCACTGGCCCACACTACTGTCTCGGCCAGCACTATGCCCAGCTGAACTTGGCCCT
GTGCATCGGCATGGCCTCTATACGGCTTGACTGGAAGCACCACCCGACTCCTCAGTCCGAGGAGATCAAGGTGTTTGCCA
CGATCTTCCCCAAGGTAAGAAGGTCGGAAAGATAAGAGAGACACGCGTTTGCTGACACTGCTCCACAGGACGACTGCCCC
TTGACGTTCACAGAACGAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62