GenePrediction:GLEAN_4107 Details

Name: GLEAN_4107
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2821407..2822506 (+ strand)
Length: 1100
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2821407..2821773 (+ strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_113:2821839..2822107 (+ strand)
Length: 269
Type: CDS
Source: GLEAN
Position: GCSC_113:2822168..2822506 (+ strand)
Length: 339
>GLEAN_4107 class=GenePrediction position=GCSC_113:2821407..2822506 (+ strand)
ATGTCTTCGATCCGCATGCGCGTCCGCGGCCCCAGCGCCACCGTCACGCTGGAGGCCGCAGCCGACTGGACGCTGGCGCA
GCTGCTGGAGCTCATCCGCGACAAGACAGGTGTGCAGAGCTTCACGCTCAAGACGGGCTTCCCGCCGACACCGCTGGACC
TCGCCGACGCAGCCGCCATGACGCTGGGCCCCCTGCAGCTGAACGGCGCAACCATCATGCTCGTGCCGACAGACAGTGGC
GGCCCTTCGGCGTCCGAGTCCGCTCCGGCACCGACATCAAGCACCCCTGCGCCCCCGCCGTTCGTCCCCAAAGGCGTCGA
TGTCGACGAGACCGTCGTGCCCTGGGACGAGGGCGGCGGTTATCTGGGTGCGTCCCTCGTGTGCATGCTCTCTCCTCGTT
AAAGAAGCCCTGCTTGCTGACTTGGCCACCAGTTCTGCGCGTCATGCCCGACGACAACAGCTGCATGTTTACGGCCTTTG
GCGGCGTCGTCGGCATCCCGGACCCGGCTGTAGAGGTCCGGGCGCGCGTGGCCGAACACATCCTCGCGCACCCAGACAAG
TACTCCAAAGTGGTGCTCGAGAACAAGGAGCCGGCCGAGTATGCGCGCTGGGTGCGGGACCCGCAGCGGTGGGGCGGCTC
CATCGAACTGCAGTGCCTCAGCGAGATCTACGACATCCAGATCTGCTCAATAGACGTCAAGGTGTGTGTGGTCTGTGTCC
GGAAGCTGTGCTGCGTGTGTGTCTATTTGCTGACTAAGCAGTATGGCCGCGTCGACACGTACGGCCTCGATAAAGACACG
CGATGCATCCTGCTCTACTCAGGCATTCACTACGACCGGATCGCGCAGACGTTTGACCTGGGCTTGCCGGTGGACATGGA
TGTGACCAAGTGGGGGACGGATGACGAAGCCGTACTGGCCAAGGCAAAGGAGCTGGCCGCCAAGCTCAAGGGCGCGCGGT
ATTACACGGATACGCAGACAATGGCAATTCGGTGCGAGGTGCCCGGATGTGAGAACTGGCTGGGATCGGGCCAGAAGGAC
ATGATAAAGCACACCAAGGAGACGGGACACACAGCGTTTTCCGAGCTGGCGATTGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62