GenePrediction:GLEAN_4109 Details

Name: GLEAN_4109
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2830884..2832896 (+ strand)
Length: 2013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2830884..2831136 (+ strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_113:2831200..2832896 (+ strand)
Length: 1697
>GLEAN_4109 class=GenePrediction position=GCSC_113:2830884..2832896 (+ strand)
ATGGCTGTGTCGGCTTCGGCGGCATATGCTGCGATGAGGGCGACACAGCAGGCTCTCCAACCGGTGCCTACGAATGCCAT
GGGTAATGATTCTGGCAGCGGCGGCGACAAGACACAAGAGCATAATGACAGCCGGACTGGGCCTGACTCCCCATACACGA
CCACAGCTCTGAGCCGCTGGTCTCTGTTGAATCGCAAGCTTCCGGACGCGGACAGCATTCGCAGTCTGCACATTTACGAT
TTCGACAACACCCGTAAGTCATTCTACACTGACTTATACGGGACTGGCAGTTGACAGTAGACCTCTGCGTGTGCAGTATT
CAAGACGCCTCTGCCGAACCCGAAGTTGTGGAACAACCCGACACTCGGCTATCTCTCCAGCCAGGATGTGATCTCGACGG
GAGGCTGGTGGCACGACTCGCGGATTCTGGCGGCGACCGGCGAAGGAATGGCCAAGGAAGAGCTGCGAGCTTGGGAGGGC
TGGTGGAACGAGCGGGTGGTCGACTTGGTGCGGCTGACACAGGCACAACCGGATGCGCTCTGCGTCCTGCTGACGGGACG
GTCGGAGAGCGGATACAGCGATCTGATCCAGCGCATGGTGACGAGCAAGGGGCTGGACTTTGACATGGTGGCGCTGAAGC
CGGTGGCAGGCCCGAATAACGAGCGGTTCTCGAGCACAATGGCGTTCAAGCAGGCCTTTCTCGAGACCCTGATGGAGACA
TACGCAGACGCAGGCGAGATGCGCATCTACGAGGACCGGCCCAGACACGTGACGGGCTTCCGCGACTTTCTGGCCGACTA
CAACAAGCGGCGGCAGCGGCGGCAGCCCATTGCCGGCGAGGTGGTACCGGTGGTGGACGCGACGACGACGCTGGATCCGG
TGGTGGAAGTGGCTGAGGTGCAGCACATGGTCAACCGGCACAACGCGGCGCTGCGCAAGAACGGTGGCAAAGGCCGGCGT
GGCCCCCTGTCGGTCAATAAGACGGTCTTCTTCACCGGCTATCTCGTCAAGGAGGCGGACTCGAAGCGGCTGCTCAGCCT
GCTGGGCGTACCACCGCCACATCAGCAGCCGGGCGGGCGGCGCGACCTGCGATACCATGCCAACAGCATTCTGATCTGTC
CGCACGCGTGTCCGCCGCACCTGCTGAGCAAGGTTGGCGGCATGGGCAGCAAGATGTCGTGGGAGGTGGAGGCGACCGGG
AGCATCGACAACAGCGTATGGGCGGCCAAGGTGCGGCCGGTGCCGGCGACGGCGACGATCCACACGGAAGGTCCGAAGCC
AGTGGTGGTGCTGGCGGTGGCGCGCAACGGGAGGCCGCACCAGGCGAACCAGATCCGCCACTGGCAGCCGGTGGCGCGCG
ACAAGGCGTACGTGTTTGAGACGACGGTGGGCGAGAAGGCACTGCTGCGCGTGGAGCCGGAGAACGGGGCGAACCGGCGT
CGTCACCACAGCAACAACAACGAGGGTGATAACACGGGCAACGGCAGCAGCAGCAGCGGCGAGGGTGATGGGGACGGTGA
TGTGGAGGGCTCGGGCGAGGGCTCGGCCGATGGTGAAGGCGGCGACAGCAACCAGACGACCAAATCGAGGGGCTCCAGGC
GGAAGAATCATTCAGGCGTTGGCGGCAACAGCAACGACCGACGACAACAACAGCAGCAGCAGCAGCGAAATGGGCCGATC
CCGACGCAGCCAGCGGCCTTTTCTGCGTTTGGTGCGCAAAGCGGCCGTGGTTACCACTTCCAAGCGACAACTCGGGGCGG
ACGAGGAGGCGCGGCTGCTCGCGGTCCTGGATTTGTTGCCGGCCGTGGGGGCTACCGTGGTGGACCGCAGCGAGGACGCG
GTGGCGGTGGTGGAGGAGCAGGCGGAGCGGGCAAGCAGCTGGGTCGAGCACAACAGCAGCAGCAGCAGCAAGGAAATCGG
CATTTTTACCAGTCTCTTGACGATGCCGGAGGGTCTGGCGGCTCGGGCGGACCGACACAGCCAATGGTGTACGACGACGA
GATGGGACAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62