GenePrediction:GLEAN_410 Details

Name: GLEAN_410
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1617459..1619312 (+ strand)
Length: 1854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1617459..1617743 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_167:1617861..1618896 (+ strand)
Length: 1036
Type: CDS
Source: GLEAN
Position: GCSC_167:1619059..1619312 (+ strand)
Length: 254
>GLEAN_410 class=GenePrediction position=GCSC_167:1617459..1619312 (+ strand)
ATGGACCAGACCATTCCTCCTTCCCCTCCACCTTCTCTGTTCGATCGCTCCTCTTCCACGCCCAACGCCTCCTCGAACTA
CGAAGATCCAACCCTCCTCTCTCACACGTCGGCTTCCGCCTACAGATTCCAATTTCCTGATCTGGCCGGCACGGCTTCGC
ACTTCGACTCCATGATGGCAAACACACAGGCACCCCATGGCCTCCCGCTCCATTATTCAAACCTCCACCCTGTCGACGAC
GCCGGTGCATACGAGATCACACCGGGAACTGCATCTGCACCAAATGTAAGCCCCCGGGGTTCTCGGGGCCCCTCAGAGTA
TCGGGACTCTCAGAGCCCTTAGAGCCCCCTTCGGTCCCGTCCAAGTAAGCGCGCCGAGCTGCAGCTAACCTTGTCCCTAC
AGCCTTACACTCTGACAACACCCGAGGCATCGCCTCCGACTGCGGTACAACATCTGCCCGGCATGGCCGGTGGCGCAGCA
GCCCCAAGAACAGCACAGGAACTCAGAACTCTGGGCGTCCGGTCGGGCCGCATAGAAAAGAACTCGAAGAAAAAGACGGC
ACCATCCCCACCCGCTCCAAAAAAGGACAAGGCCGCGGCAACGGCAGCAGAAGCAGCAGCAATGGAAACGGAAACGGAAA
CGGCGGCCGAGGTATCGGGCCCTCCTGGCCTGTCCACGCTGGACAGACCACTTAGCATCCTGACCAAGGACTGGGAGATC
CCGGTTGTTGACATTGCCACATACGTCCACCGGTCCGTCGAAGATCGCCGCACTGAGGTCGAACAAGGCAAGGTGCCTGG
CAAGATCAAGCGGGCCATGAACGCATTCATGCTCTACCGCAAAGCATACCAGGACCGCGCCAAACGGTGGGCCCAGCAGT
CGAACCACCAGATAGTGTCCAAGGTGTGCGGCCAAAGCTGGTCCATGGAGCCGAGAACTGTGCGTACCCAGTTCAACGAA
TGGGCCAACATTGAACGCGACAACCATCGCATGGCTCATCCGGAATACAAGTTCACCCCATCCAAGCCCCGTAAGAAGAT
CGGCGACACGTTCGATGACTTCTCTGACCCGGAAGACCCCGACTGGGACGTCGGACGGCGTCGCTCAAACAGCAGAACAC
CCCTGCGCGACCTGGACGGCGACTACCGACCGTCCCATACTCCATACACAAACCCGTACGCCACTAGCGTGTCCCACTTG
CCGTCGTACTATCCTCTCCAACGTCCCTCTCACCTGTCGGGTCCGGCCGGCCACTCGGTGTCCATGGCATACGACACAGA
CCCATACGGCACAGGAGAACTGCACTACCAGCCCGTTGCGGTCGCAGGAGGCCACCCTCATCAACCCCAACACCCACTGG
GTTCTGGGCTGAGCTTCACCACGGCTCCTCAGAGCATGGACCTTGGCACAGCTCACCACTCCATGGACGCTCACCACCGT
GCACAACACAACAGCTTTGACTATGGCGATCACTATACGCAGCAGGTTCTGGCACAGCAGCAGCACCAACACCAACATCA
AAACCAGCAACAACACCAGCAACAGCTGCAACAGCAGCAACAGCAGCACCAGATGGCCGGTGCCACATCTCACCTAATAG
GCTTGGGCCAGCACGTCGATCCAGCTTTAGCCCACTATGACATGTCGGGGCCACTCATCGGCGACAACTGGCAGCCTGGC
ATGCCCCTTGGCATGCCGCCCAACAGCGCCGAACAAGACATGTACGCTGGTCCATACTTTGCTGAGATGGACGAATCCTA
CATGCAGGACAACCAACTGCAATATCTCCGCGGGGGTGATGAGACCTGGAAGATCGACACTATCAATGAATCGGAGGTAT
GGCATCCGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62