GenePrediction:GLEAN_4110 Details

Name: GLEAN_4110
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2834765..2837819 (+ strand)
Length: 3055
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2834765..2834897 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_113:2834968..2837819 (+ strand)
Length: 2852
>GLEAN_4110 class=GenePrediction position=GCSC_113:2834765..2837819 (+ strand)
ATGGCAGACGGCGGCACATCCGAGCTTTTCGCCATTCCCGACTTTTGGAAGTCGTCTACTTGGCAACAGGAGCTCGGTCT
GGCCGATGCTTCCGACGAGACGCCAGATGGTTTTTTTCATCTCAAGATCGGTGGTATGGCCCCAGATATGGACTGCATCC
TGTCGATTGCTCAACAGATGCAAGCATGTACTGACGTCTGCAGAAAGCGATGCGATCACGCTGTTTCTCGGACAGGACGA
GCCGCCCGATGACGACCGAGAGAGCACGTTCTTTCAGATCCCGGCCCTGCTCCGAGAGCTGCAGCCACCAGTTGAGGCAA
ACGAAGACGACTCGACACAGCAGCCATTGGCTGTCGTAAAGTTGGCCCTGGAACCCCCTTCTGCCGGCAATGACGACGAC
GATAGTGACCTGTGGCTCTATCCCGACGAATACCTCCTCCCGTCCGTCCCCGGATACAAGTCTTGGACGTCGTTTGCACA
CGCAGACAGCCGGAATCTGGTCTCGATCCCTGTTTTGGCGTCAGAGCAAGGGCCTGCGTTTCTGGATGCTCTCGTGCTCT
CGGACGACAATCTCCTCGGGCTCAAAGTGACAGGTGGTGGCGACAGCCTCGTCGTGGATCCGCGTGGATACTGCAGCTGT
CTGCTGGCATTGGCTCTGGGCCGTGCATCTGTCCTGTTTTCGTGGGACGACGACCGGCGATGCTTCGTCGCTCTGCATTC
GTCACCCCGGATATCTGGCTTCACCGGACCCATTCTCCGCAGTGTGGAGCGGACGTGTCTGGAGTGTGGCACCTACAGCC
GATCGCTGCGGGCCTTTGTCGACGTCTCGTTCACGTCGGCCACATCGGCCACGCCGTCTCGTGCCGCGCTAGCTCGCGCA
GTCGACCGCCTGCTCCTGACCATCCAGAGTGAGCTCGGCGTGCGTGGCCAGCGGTCCCGATCCGTCCTGCAACTGCAGGC
CCTCATCCGACCCGTCGCCGCTGTTGTCAGGTACATGCGCGGACTCGTCGTCCAGCTCTCGCGCTGCTCGGCCGACGACG
GGATCCTGCTGGCCACGCTTTTCCAGGAGGCCCAGTCCATGGAGCACAGCGCTCCACTCCTGCGCGAGGTCGCCAAGCAG
GTCCTCCAGATCGTGTCCGAGCCCTGGCTCGGCTTTGTCGGTCGCTGGATCGGCCTGGACCCCCGGAGCAAGAACACCAT
GTGGGCCGGCCAGTTCGAGAGCAAGGCCTTTGTTCGCCACGGCGACCGCGTCTGGATCGACGACACCGGCGCCGAGCAGG
CCGAGCCAGACTACTTCTTGGACGCCGACAAGATGCCGGCCTTTATCCCCGACGAGATGGCCCAGGCCCTGTTTGAGACC
GGCCGCAACCTGCGCTTCCTGTGGACCAATCACCCGGAACACGCCCTCTCGGACCCGGCCACCTTCGCCCGCGCTGGGCC
CCCACCGCTACGCTGGCAGTTCGACTGGGAGCCCGTCCTGGAGGCCGAACGTGTGGCCGATGCGTACGAACTGGCCGTAG
CCGTGGCCATTGCCACACACCAGCGGCGACGACCAACGTTTCAGCTGTCTCAGGCGCGGCAGCCGCCGACGAGCTTCGAG
ATCGGCTGGAGCCTGCCGTCTCTGGAGCTGCAGTTCTTTGGGAAGGACAATGACCAGATCGCCAGTGGCATTGAGGCGTC
CATGGCCACGCTGGACGGTCCTGTTGCACATGCTGCCGACGACGGTCTGACCACGATTCTCCGACAGCGGCTCTTTGACG
ACTACGACAACGACAACAGCAATGCGGAGACGCTGGTGCTGGACGAGTTTTGCCCGCACTGGTCGCTGCTGCCGCTGCTC
TCGTTTGGGCCTGTCATGGCGGCCCAGGCGCGACTCGTCAGCCGCGCGTGCATGCAGCTGCTCTTTGGCGCACACGACGT
CCGGAAGCACCTCCGGCTGCAGCGTGAGTTCCAGCTGCTCGGCAATGGCGTCTTCTGCAGCCGGCTGTCGCACGCACTCT
TCGACCCCGACCTGGCCGGGGCGGAGGCGAGGACGGGCGTACAGCTGTCGAGCGGCGGTCTGGGCCTGCGGTTGTCAAAC
CGCGACAGTTGGCCGCCTGCCAGCTCGGAGCTCCGGCTGGCCCTCCTGGGCGTGCTCGTGGAGAGCTACCAGGACGGCAG
GAACAGAAAGGGCGGAAAGGACAAGATGCCGGGAGATCTGAGCTTTGCGGTGCGTGATTTGTCAGCGGAGGAGATGGACC
GCTGCATGGACGCAGACTCGCTGGAAGCGCTGGACTTTCTGCGGCTGTCCTACAAGCCACCATTGGCGCTGCTGTCGGTG
ATGACACCAGCGATCCTGGTCAAGTACGACCGTGTCTTCAGGCTGCTGCTGCGGGTGTTGCGCATGTACTACGTGGTCAA
CCAGCTCAGCCGGGAGACGTCTGTGCGCAGGGCTACGGCCGCAGCAACGGCAACGGCTACAGTAGGCGGCAGCTTGCAGT
CGCCCGACGATAGCGTGGCGACGCGCTTCCGCTTCGAGGCACGCCACTTTGTGTCCAGCGTGATGGCGTACTTTCTGGAC
ACCGGAGTGGGGACGCCGTGGCAGGCGTTTGATCACTGGCTCGACGACGTGCAGGCCGGCTTGGACGGCTTGGACGAAGG
CGAAGGCGAAGGCGAGTCGAATGCGACAAAGCACGTGATCAGCCCCGAGCGGCTGCGAGAGCGCCACGAGCAGACGGTCG
ACGAGGTGATGGCGGCGCTATTTCTGCGCAAGAGACAGCAGCCGCTGCTCGAGCTGCTCGAGACCATCTTCGGACTGATC
CTGGACTTTGCCAAGCTGTCGCGCAGCCGGGCGTCCGACCAGACAGGCCTGCAGCAGCAGACGGTCAGGCTCCACGCCGA
CTTCCGCAAGAAGCTGGCCGTCTTCCTCACCGTCTGTCGCGGCCTTGGCGAGAAGCAGGCAGACAGTGCGGCCCGACGGA
CCCAGCAGCTGCCCCAGCAGTCAGGCCCCTCTCTCGCCGGCCTGCTGCTGATGCTGGACTACAACGGCGCCTTTTCAGGC
TCGCCTGGGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62