GenePrediction:GLEAN_4111 Details

Name: GLEAN_4111
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2846445..2847915 (+ strand)
Length: 1471
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2846445..2847177 (+ strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_113:2847248..2847915 (+ strand)
Length: 668
>GLEAN_4111 class=GenePrediction position=GCSC_113:2846445..2847915 (+ strand)
ATGGACGGCTCACACTATTCGTCTAACGTGATGAATGGCACATCGAACCAGTCCTACCCTTCATCTGCCTCGTCGACGCC
ACAGAATCTCCAGCCGCATACGCTGCCACCCCTGCAGCAGCAGCACCAGCAACACCCCCAACACCAGCAGAACAACGGCA
TGATGCATGCGGGCAATCCCTATGGGAGCTACCCACACACTCCACGGACGCCCGCAACCCCAAACACCCCGGGTCCTGCC
AACATGACCGCTTACCCTCCTCCGCCGACCACTAATGGTGGTCGAGGCTACCAGATGATGAGCAATGCCTACCAGCAGCC
TCATCAGTATGGCGCAACCTCGTCGGCAATGCTTCCCCAGTCCTCCACCGCAATGGCCCATCCCCAACCCATCGCCCCGG
CACCGGCTCCAGGCTCTCGGGGTCCACCTGTGCTGCGTCCTATGCCTGCCGGCGGCGTCATGCCACAACCAGGGATGTCT
TCGCCTTACAGCCAGAGCCCCATGATGCCTCAGGCAACAATGCTTCCCGAGACCGAGCAGCCGACCCACGTGGTTGGCTC
TCAGGGCCGCCGAGGCATTCTGCCGAGCGCCCCAGGCAGACCCGCTCCCCCAGCTGCAGGCACGGTCACCAAGAACCAGA
TTCCCCAGAAGGACGCCGACGGGAAGTTCCCTTGCCCTCATTGCACCAAAACGTACCTCCACGCAAAGCATCTGAAGCGT
CACCTTCTGAGACGTAAGTTTACTTTCCAAGTGCATCCCTTTTCTACCTTTTCTGTGCCTGAAAAGAAAACTGACAATCG
CAGACACCGGCGACCGCCCATACATGTGTGTTTTGTGTCGCGACACGTTCTCGCGCAGCGACATTCTCAAGCGTCACTTC
CAAAAGTGCTCTATTCGTCGTGGTAACCCGACGGGAGCCAGCCATCTGTCGCACCCACATGCCCATGTCAAGAAGAATCA
GCAGGCGGCTCAGAAGCACATGGCCGAGGCTGGTGATATGAGCCACATGAACGGCATGGGCAACGTTCAGCCTGATGGCA
TGGTTCACCCCTTCGGGCTGATGCCTGCGGGTAGCGACGGAATGTCCAATGACCAGGCCCAGCTGTCTCGTTCGAACAGC
ATGAACCGCATGGACGATGCTGCTGCTGCGGATCAGAACCGGCGTAACGCTGCCGCTGCTGCAGCTGCTGCAGGCGCCGC
CGGAAACGTCATGGGTGCTCCTACCCGCGTCGGTAACGGCGGCCCGGGTCCCCAAGGCCCAGGTGGCTCGTATGACCAGT
CTCCTTATAATGGAAGTGTTCCTGGTGGTATGAACCCGCAGCTGGCCAACTACAACATGCCGGGTAACCAGAATGGCATG
CCTATGTTCACTGGCCAAAATGCCAACCCCCAATCGAACCTCGATTGGTCGTCGATGTTTCAGGCCGGTGCGCAACATAC
CTACACCAGTCAATCATCTGTTCCCATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62