GenePrediction:GLEAN_4112 Details

Name: GLEAN_4112
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2850329..2851184 (+ strand)
Length: 856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2850329..2850889 (+ strand)
Length: 561
Type: CDS
Source: GLEAN
Position: GCSC_113:2850954..2851184 (+ strand)
Length: 231
>GLEAN_4112 class=GenePrediction position=GCSC_113:2850329..2851184 (+ strand)
ATGGCTACGCTGGCGCCTTCTGCGGTGCGTGCGCGTCTAGCAGTGGTGCTGCGCCGGAGTGCAGCAGCCCCTTCCACTTC
GCCGTCACTACCATCACATCGACCACGGCTACAATGTGTGTCGGTAGCAGCGGCAGCAGCCTTTTCTACATCTCCAGCGC
TCGCAAAGCGCCGTCGATACCAGCCCCGCGACAACAACCGGCTGCGAGGCGTTTCCAGCACCCGGCGAACCGGCCCCCGC
GAATTCCTGTCCGTGTCGGACGAGCGTCTGCCACGGCCGGCAGAGTCTGCTAAGGCGGCGGCGGCAAAACCCGAGATCGA
CCCGGAGCACGGGTTGTGGCAGTTCTTCTACGACGGTCAGGTGGCACAGCCGCCGGCTAAGGACGTGGCGTTTGGTCGTG
CGTGGACGGCTGAGGAGCTGCGGCGCAAGAGCTGGGACGACCTGCACCGGCTGTGGTGGGTCTGCGTCAAGGAGCGCAAC
CGGATCGCGACGGCGGCGGTGGCACGAAAGCAGTTTGATCTTGGCTTCGGGCAGTACGAGAGCGAAGAACGTGATGCAGC
GGTAGGCTTGCCCGCAATCCCATTTCTGAGGCCGCAGGGACATACTGACGATGATGTTGCTTCAGGTCAGACAAACGATG
CGAGGCATTAAGCACGTCCTGACAGAGCGTTTCTACACTTGGGAGGACGCAGTGGACCTGGCACGATCGGACCCGGAAAT
TGACCTGTCGGGCGAGGGTCCGGCATTCCGACCGGCAGCATACCTGGAGGACGAGGGTCCGCTAGGCAGCGAGGAGGCCA
GCATGACTGCTGAAGCACAGACAGAGGCTGGGCATCAGCAGGCTCCAGCGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62