GenePrediction:GLEAN_4113 Details

Name: GLEAN_4113
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2851805..2853663 (+ strand)
Length: 1859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2851805..2851850 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:2851922..2851946 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_113:2852032..2852091 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_113:2852216..2852243 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_113:2852314..2853205 (+ strand)
Length: 892
Type: CDS
Source: GLEAN
Position: GCSC_113:2853261..2853415 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_113:2853472..2853663 (+ strand)
Length: 192
>GLEAN_4113 class=GenePrediction position=GCSC_113:2851805..2853663 (+ strand)
ATGGACGAGATTGCCAAGGAGTACGATGTCATTGTGCTGGGCACAGGTAAGCTGGGCTGCAGACGGACGAGAAGATGGCA
AAAAAGCTACACGAAGCGCTGACCGATGACTGTGTAGGACTGACCGAATGCATTCTTTCTGGGTGCGTCATTCCGCTGCC
GACTGGCCCCGATGCCGCGGCCGAGCTGCGTGTTGTATCGTGCTGACAGCCATCTCTCTGGATGTAGTGTTCTGAGTGTC
AAGGGCAAGAAGGTCCTGCATATTGACCGCAACGACCACTACGGCGGGTAGGTTCTTGAAAAAAAGAAGAAAAGAAAAAG
AAAGGAAGATGCGGGGAGGAGAGAGCGCGTGCAGGAATACCTCTCTTCCTGTCTCAGATGCAAGATCGGGCTAGAGCTAA
CCGCGACGCAGTGAGGCAGCATCTCTGAACATTCAGGCGGTAAGCTAGTGAAAACGGTCCCCTGTCCTTTTTGTCGTCCC
AGCGGGAGCATGCAGCTGACGGGTGGCAGCTGTACCAAAAATACGGCAACTTTGCTGCAGGCGAGGAGCCCTGGGTCAAC
TATGGCCGGGTCAACGACTGGAACATCGATCTGGTGCCCAAGTTCCTCATCTCGTCGGGCGAGCTGACCAACATCCTCGT
CTCCACCGACGTCACGCGCTACCTTGAGTTCCGCCAGATTGCCGGCAGCTTCGTGCAGCAGGGCAATGGCCCTCGTGCCA
CGGTCGCCAAGGTGCCGGCTGACGCGGCCGAGGCGCTGAAGTCGCCGCTGATGGGCATCTTTGAGAAGCGCCGCATGAAG
AGCTTCATCGAGTGGATCGGCTCCTTTGACATCAAGGACCCGGAATCGCACAAGGGCTTCGACATGGCCACGTGCACGAT
GAAGGACATCTACGACAAGTTCGGCCTCGAGCCGGCCACCAAGGACTTCATCGGCCACGCCATGGCGCTCTACCTCAACG
ACGCCTACGTCGACGCTCCCGGCAGCGCGCCCGAGGCGATCGAGCGCATCCGCCTCTATGGCAACAGTGTCGCTCGCTAC
GGCAAGTCGCCCTACATCTACCCGCTGTACGGCCTGGGCGAGCTGCCCCAGGGCTTTGCCCGTCTGTCCGCCATCTACGG
CGGCACCTACATGCTGAACACGGACGTCGATGAGCTGCTGCACGGCTCCGATGGCAAGATCTCAGGCATCAAGGCCACCA
TGATCAACGGGGACGAGAAGGTCAAATTTGAGACCAAGGCCAAGCTGGTCATTGGCGACCCGTCGTACTTCCCCGACAAG
GTCAAGGTTGTCGGCCACGTGCTGCGGGCCATCTGCGTGCTCAAGCACCCGCTGTCCAGCACCAACGATGCCGACTCGTG
CCAGCTGATCATTCCACAGAGCCAGGTTGGCCGGAAAAACGGTGAGTGTGTGAGAGCAGGTGCAGATAGTAGAATAAGCA
TATGCTGATTAAGCAGACATCTACGTGGCCTGCGTGTCATCTGCCCACAACGTGTGCCCCAAGGGCTACTGGATCGCCAT
CGTGTCGACCATTGCCGAGACGACGGCCAACCACCACCTGGAGCTGCAGCCGGGCATCGAGCGTCTCGGCAAGATCGAGG
AGCAGTTCATGGTACGCTGTCTGTCTGCCTTGCTCTTCTCGCTGTGCACTAACCGTCGTCTGTCTAGGGACCGCCCATCC
CGCTGTACGAGCCGAACGAGGACGGCACCAAGGACAGCATCTTCATCTCCAAGAGCTACGACGCCACGTCCCACTTCGAG
ACTACTACCGACGACGTCAAGGACATCTACCGCCGGGTCATGGGCGAGGAGCTGGTTGTGGAGGGCCTGCGGGAGGGCAT
CCAGGTGTCGGAGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62