GenePrediction:GLEAN_4114 Details

Name: GLEAN_4114
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2853984..2854686 (+ strand)
Length: 703
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2853984..2854223 (+ strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_113:2854287..2854332 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:2854400..2854686 (+ strand)
Length: 287
>GLEAN_4114 class=GenePrediction position=GCSC_113:2853984..2854686 (+ strand)
ATGTCGCCATTTCGCTACAGCCTCGCCGCGAAGGCGCCTTTGGCGCTTCTGCGGGCCTCTCCTCCTGTGCCTCTAAAGCG
AGCCTTTGCAGTGCGCACGATAGCGACCACCTCGTCTGCGTTAGTGCGAGCCAATGCAGTGGCCAAGGGCAGCACGCAGA
GATCGTGGGTGGCCGTGCCTCTGCGAAGAGCGTACTCGTCGGCGCCCGAAGCGGCCGGCAAGACGTGGTCGTTCGAGGAG
GTGTGTGGGATGGTGAAGAAGCCTGAGCCAGGATAGAGGCGGACGATGCTGATCGTGCTGCAGCTGCAAACCGCGACCAA
GAAGGCCGGCTCGACGGTGATCCTTGTTGGTGAGTGATGGGTCTGCGAGGACGTGTCTTGTGAGAGTTCAAGGCCTGCTG
ACCAGGCGTGCCGCAGACGCCCGCGAGCCCGGCGAACTGGCGGCTACCGGCCGCATTCCGGGCGCCATCAACATCCCCGT
GACCTCGTCGCCCGACGGCTTCTTCCTGCCGGACGAGGAGTTTGAGGACCGCTTCGGGTTCGAGCGGCCCGCCCGTGACG
CCGAGATCGTCTTCTACTGCAAGGCCGGCGTGCGCAGCCGGGCTGCCGCCACGCTGGCCCGCGATGCCGGCTGGACCAAC
GTGGCCGAGTACCCGGGCAGCTGGCTGGACTGGACCGGAAAGGGTGGTGCAGTCGAGCACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62