GenePrediction:GLEAN_4115 Details

Name: GLEAN_4115
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2864486..2866648 (+ strand)
Length: 2163
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2864486..2865430 (+ strand)
Length: 945
Type: CDS
Source: GLEAN
Position: GCSC_113:2865494..2866648 (+ strand)
Length: 1155
>GLEAN_4115 class=GenePrediction position=GCSC_113:2864486..2866648 (+ strand)
ATGTGGCTCGACCGCTTGAGCCATCCGGGTGCCGGCCCCCCGCAGAACAACATCAATCGCTCAGGATCACCCTTGCCGAG
GAGTGTGTCTGGCGCCGGCCGCGGAGGACCCTATGTGACGTCGCAGCGGTCGGCGCGCGTTTCAGCGCAGTCGCTCATCT
CTAGCGACTCGACCACTTCGCTTCTTACATACTCCCGGCGGATGAATGGTTCGTCGCTGAGGCAGTCGGTGACCGTGGAC
GCGACCGAGGACAAGGCAAAGGATGCAGCCGCGCTGGCTCTGCTGGGAAAGCTCCTCGCAGCCGATGATGAAAAAGGCTC
ATTGGAGTCCTCAGCTACAGCCACGGAAACGATTACGGACGAGGACCTCGAGCTGGACTTCGACTTTGGTGGGCTCTCTC
TGCGACAGATTGTCTGGAACGGACCTGGCGGCTTGCAAGGCGATGATGTTGCGCGCTCTACACAGACGCCGGAAGAGCGT
AAGCCGTTCCTATCACCGTCTATCTCGGACGAAGTGTCTGTTGTTTCTCTGCTGACAGGCTGTCCAGTGGAAACGGAACG
AACCAAGCTCGAAGATCTTCACAAGTCGATCCGCGCGTGCGACGAAGTGCTGAACTCGGTCGAGACAAACCTGACGAATT
TTCGAAACGACCTCGTGCTAGTGTCTGCAGACATCGAAAATCTGCAAGCGCGGTCGACGGCTCTCAATATCCGGCTGGAG
AACCGTAAGACGGTCGAGAAGGGACTGGCGGCGGCGGTCGAGGATCTCAGCGTGCCGCCCGCGCTCGTCAACAGGATTGC
CGAGGGCAATATCGACGAGCAATGGGTGCAATCTCTCAAGGAGGTGGATAGGCGAGCAGCGGTACTGCGGAGCGGAAGCG
AGCAGCAGAAGCAGGGCAAGGCCGTGCAAGATCTCTTGCCGCTGATTGACAAGCTGATTCTAAAGGTAGTCTTCTCCTGG
CCGCCGGTGCCGTGTTGTTTGCCGCTGATCTGACTCGTGGCACTGCAGGCGATCGAGCGAATACGAGACTTCCTGGTTGC
CCAGGTCAAGGCGCTACGGTCTCCGCACATCAACGCGCAGATCATCCAGCAGCAGAGCTTCCTCAAGTTCCGGGACCTGT
ACACGTTTCTCCACAAGCACCACGCGACGCTGGCGGACGAGATTTGCCTGGCATACATGAACACGATGCGCTGGTACTAC
AGCAACCAGTTTGGGCGGTATGCCAAGTCGCTGGAGAAGCTGCGGCTGCACGTGCTGGATAAGAACGACGTGTTGGGCCA
CGACGACCTACACTACGGGTCCTCGCGCAAGGGTGGCGGCAGTAGCGGCGGTGGAGGGCCGGGGGTGCGGCATGACGCCT
TCAGCCTGGGGCGGCGCATCGACCTGCTGAAGGGCCCGAGCCAGATAGCACTGTCTTCGTACCTGGCAGAAGAGGATACG
GCAGCTCACTACCTGGAGGTGCCGTTCCGACACTTCAACTTGGCGCTGGTGGACAACGCAACGGCCGAGTATACGTTCCT
GGCCTCGTTCTTCTCACCGGCACTCACGTTTGCGACGATCGGGCGGCACTTCCACTACATCTTTGAGCCGACGTTTGCGC
TGGGCCAGGCGCTGACGCGGTTGCTGACGGCCGACTCGTACGACTGTCTCGGTGTGCTGCTCTGCATCCGGCTCAACCAG
CACGCGGCCTTTGAGCTGCAGCGCCGCAAGGTGCCGGCCGTCGACAGCTACGTCAACGCAACCAACATGCTGCTGTGGCC
GCGCTTCCAGGTGATCATGGACCACCACTGCGAGAGTATGCGCCAGCTGGCTGCAGCCGTTGCGGCATCGCCTTCGTCTT
CGTCGACGGCATCGACGGCCCCCCACGTCATCACGCAGCGCTTCGGTCAGCTGCTGCACGGCATCCTAGCGCTGAGCACC
GAGGCCGGCGACGACGAGCCGGTGGTGACGAGCCTGCACCGGCTGCGCAGCGAGTCCGAGGCCTTCCTCACGCGCTACAG
CCAGGCCGTCTTTGGCAAGGACCGGCGCAAGCAGGAGCGGTTTCTCTACAACAACTACTCGCTCGTGCTGACCATTATCA
GCGACGTGAACGGTGGCAAGCTTGCCGCCGACCAGAAGCAGCACATTGAGAGCCTCAAGGCGGCCTTTCAGGAGGGAGCA
TAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62