GenePrediction:GLEAN_4116 Details

Name: GLEAN_4116
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2872189..2876682 (+ strand)
Length: 4494
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2872189..2872422 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_113:2872533..2873699 (+ strand)
Length: 1167
Type: CDS
Source: GLEAN
Position: GCSC_113:2873800..2874320 (+ strand)
Length: 521
Type: CDS
Source: GLEAN
Position: GCSC_113:2874385..2874707 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_113:2874779..2876682 (+ strand)
Length: 1904
>GLEAN_4116 class=GenePrediction position=GCSC_113:2872189..2876682 (+ strand)
ATGGCTTTTCAGACCAATGTGTTTCGCCACGGCGAGTGGGTGACCGAGACCGTCGATCTACAGGCCGTCCTCAAGGCAAA
CTCCAATGCCTCCGCTAAGCCGCTGCGACAGCGAGCTGCTCACCCCCCAGAGTGCGGTATCCTTACAAGAACCGTCATCG
AAAGCCCCGTGGCCAATTGGATACTTCCTGTTCGCTTAAGATCTGCACAGCATATGGACGTTGCTTTTATAGGTGTAAGA
TATATCCCTTCTTTCTGCCGCAACCCCACCCTCCGACCGCTCCCTCTCTCTGAAGTTCATCCCAACTCTGCCCGGGTCTG
ACCGTGTGAGTCGGCTGCTTATAGGACCACTATGTACAAATCAGCGAACTGGGGGAGGATGGTCAGCTTCGAGACATCAT
CAGGAAGACCGATTTCGGATCCCGCATCAGAAATGCCAAGGTTATCGGACCGCCGCCAGATAGTACTAGGGACGATACCG
AAGTCAAGAGTGACGACATTATGGTCAAGGTCGAGGAGGGCGCTGCTTTTTCAGACGACGATACCGATGTGGCTATGAGC
GATGCTGGTGTGCCGCTACCTCCCGCCGCCTCTCCTAGTCGGTTGACACGATTGCCTCCCCAGCAGCTCATGATCGTTCT
GGAGTCCGGAGACTGTGTCTTTCTCTTCGTGCGACAAGGAGTCACTGGGGAGTATGAATTCTTCGACACTCGAGTCGACA
TACCTAACAGCCAGATCGCCCAACCCGGCTTCCACGCAGCTGTCGACCCAAGCTCCCGCTACATGGCTTTAGCTTGTCCG
GAGAATCTGTTCGTTGTGTATGAGCTCGAGTCAAAGTTGGAGCTGAACAGACGGTATGCGCGTGGCGAACCTCTACGACC
GATCAAGTCATTTCGGGCTCGAATGGTGAATGGTGTCATTCACAAAATGGAGTTTCTGTATCCGCACCCGGACGACGACT
ATCACATCATCCTGCTTCTCATCATTGTCATGCATGGGAAATCAAGGATGGTGACGTATGAATGGGGAGGGCGGGGCGAT
GACCTGGTTTCCGTTCTTTCTGAGGCGAAACGGGGACAACCATTACCTCCTCAACACCAGATCCCTCTCCTAATCATCCC
ACTAACCGTCCATTCGGCCTTTTTTGCCATTTCGGCTCGTCGCATCGCTGTCTGCAAGGATGCTCTCACCTTACCAGCCG
AATTCGACGACTTCGTCATGGACGTTCAAGAAACATCCCGCTTTCACCACGGTTCAGGTGAACCGCTATGGGCTGCCTGG
ACACGGCCCTACCGTCTTCCCACGTATAGGACGACACGGGATAACATCTACCTTGCCCGCGAAGACGGTGTCGTCATGTT
TCTAGAGATTGATTCGGACAATATACTGGGTGCCTCTGTCCAGATCGGCAAGTTTGATTGCAATATTGGTACATCATTTT
GCAGCCTGTTGGATGACTTCAACGACATTTTGATCATGGGCGGCGACTCTGGACCGGGCTCGATTTGCCAGGTAAGTGTT
GTGGAGTGGAAGAGGCCTGGCGAAGAAGAGAGGAAAAAGATAATGCGCGCTTCCCGAAACTTGCAGAAGGGTGTTTAACA
AAGTATAACAGATCCGTCCACGAAAACCTAACATCCCGCTCGGCACCATTCCGAACTGGTCTCCAGTAGTAGATTTCGTC
ACGAATGATAAGTTCTCAGCAGCCGTTCGTCTCGTGGGAGAAGCAGGAAACAAGATCATCCCGTGGCAAGATCGCCCCCT
CGGCAGCTTTTCCAACCCAGACCGGATATTCGCTACCTCTGGCCATGGTGTTACGGGTGCCGTCACCGAGTTCCGCTTTG
GCTACCGCGCGAACATTGGCCTGGACATAGACTATGAGACGCCCGTGAAACAGTCTTGGATATTTCCGACCCAACCTGAG
AGTGCCGACCCCGAATTTCATCTGCTCATGTCTTTGGTTGATAGAACTGTGGTCTTGTACCTATCCAGCGATCTTGAAAA
GTATAGGGAACCGGATGCAGACTTAACACAGTACGACTTATCAACCAGGACAGTGGCTGCTGCTCAGATGTATGAAGATG
CCGTCGTGCAAGTGTCAGAAAAGTACCTGGTGTTTATTAGCCCAATGACAAGGTACTATAGCAATGCGAAATCGGGAAGC
GCAAAGTCAGACCTTTTGCTAACTTTTCTGTGGTAGTGTACGCCGGCTACATGCCGACATATTTCAAGACTCCCAGGTCA
CCGTTGTGGACGCTTTCATACAAGGGAATCTTGTCGCCGTCTCCACAAACGTCGGAGTTGTTTTCCGCTTGTACATTGTG
CAGCTCGATGCTAGCGGAACAATCAAGACTGCGAAATCATATGGACAAATGGGCGAGGTGACATGCCTGTGTCTGGCAAC
GGTAGAAGGCTCGCCCTACCTTGTGGCCGGCCTTCTGAAAGACAGCCATCCGTCTCTAGTCCTTTACAATGTTGGCGCCG
AGGGCGAAAGCGCCCTCTGTGTCGTCGATGTAAACTCTAGTAAGCAAGACCAAAGCACTTTCCTGGCACGTCTCGTTGAG
ATTTTACGCGATTTGCTCACCACTTCACAGCTGAAATTAGCAAGCTACGGTGTGGGGGACAGGAGGATGCTGCTCGTTAT
CCTTCGCTGGAGCCACTGACAAGTGTCTTGCTCAAAAAATCCGAAGATGGCTCGATGGCGATTGTGTTTGGTACAAGGGG
AGGAGACATGGTCGCCTTGACCATTGGGTTGGCTGGCAGTGTCTTGGCGGCTAACTCGGAAAAACTGGGCCGTACGGCAA
CCCATGTTGTCTCGGTCGAAGACCCAAACCTGAAGACGGCTACACTTGCTGTTTGTGATGGTCGGCTTTCCCTTATGTCT
GATTTCGATGCGCGCCGGGCTTCTTTTCGGTCAATGCACACGGTCTGGCTTGAGGACGCATCCGACACCAGCAAGGAATC
GCCCTTTGTCAGCGCCGCCTCTGTTCTTCAGAAAAGCCTGCCAGGACACCAAAGCAAGACCCAGCTGACGTTGACGGCCA
AAACTAGAGTTTTGTTGGTGGAATTGCACACGCAACCTAGGCCGGTGCACCGCAGTCTACCAGTGATGGGAACACCCTTG
AAGGTCATCTACTCTTGCATGCTGGACTGCCTCATCGTGGCACTGAAAACATTGGACGACAAGCCGACGCTTCAATTTCT
GGACCCGGACACGGGGGAAGACCTGTCCTTCCCGACGGACAAGTACAATGAGCCGGTCGAGTTCGTGTCAGGGCTGGGAA
AGACTGGAGATCACATTTTGGGGTTGGACGAATGGCAGTACGAGCGGAATGGTGACAAGTGGCTGTTTCTTTTGGTTTCC
ACTAAGGGCGGTCGCCTTCTCGTGCTGTCGACAGTGCCAGTTGCCAAGAACCAGGAAGGACGCCGCCAGAAGATTAGATA
TTGGACGCGGTATAAAAGATCCACCGCTACAGAACCGATCTATTCTGTCGTGGGTTGGAACAACAACGTCTTCTACTGCA
TGGGCTCTACGCTCTACTGGGATCAACTCGACGTGGAGGACCGGAGATTGAGGACACAAGGGACCTTTGAGCTCGCTTCG
TCCGCAACCAGCTTAAGAATCCTGAACGGAAGGATCGTTGCGTTGACAGAGCGCGACTCGGTGGAGATAATCAGCATGAC
AGGGGAGAATCCAGGCGAAATGACGCTTCACCACGCCGACTCGGAGTCACGGACGGCGGTGCATATGATTGAGATCGGAG
ACAAAACGGCCGATGGATCTGGGGCGTCGGCGGTACTTTTATCGAACCGAAGCTGTGGAGTGGCCGGACTGTTCATTCCT
TGGCAGCAGCCGGGGAGAGACTGTGAGGTGATTCTGGAAGCAGAACTGCCGGCATCGATTCGAAAACTTGCACGCGGGCG
AACACGGCCGGTCTGGCAACAGGCACGGCGCGACGTCCGGTATGGACTGCTACCCAGCACGCTGGACGGGGCAGAGATCT
TGGGAATGTGTATCGACGGCTCGCTGCAGCACTTTACTCTTCTCAGCATTCCGATTTGGCGAATACTTCGGCTGATCCAG
AACCTGGCATTCACCACCCCTACGCTCTACCCCTTTTTGTACGAGGTGCCGGGGCCCGATTTTGACGAAGAACCAGAGGT
GGACCAGTCGTATGGCATGCAGATCGACGGAGACATGTTGCAGAGGTGTCTGGACAAGCGAGCGCTCGAGGAGCTGTTTT
CAAGCGCATCGCGCACAAATCGGCTGTTTGAGTTGCTCGAACAGCTCGATAATGGGCGATGGACAGCCGCGATTGGGAAG
AGCTCTGAAGGCCGGGAAGAAGACCGGGAAACAGAGCCAGGTATGGAGGACGGAGAAGAAGGCGACTGCGCCGACGAAGG
GGATGCCAAGAGGAAGAAGAAAGAGGAGAAAAAAAGCAGCTATCTGGCTCTTCTCTATGACATTTTGGAGTACTACCTGG
CCCCGGTGCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62