GenePrediction:GLEAN_4117 Details

Name: GLEAN_4117
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2877572..2880839 (+ strand)
Length: 3268
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2877572..2880534 (+ strand)
Length: 2963
Type: CDS
Source: GLEAN
Position: GCSC_113:2880593..2880839 (+ strand)
Length: 247
>GLEAN_4117 class=GenePrediction position=GCSC_113:2877572..2880839 (+ strand)
ATGCCGCCTAAGAAGAAGGGAGGCAAGAAGGCCAACGATGACTGGGAGGCTGAGCTTGGGGAGACCATTGCGCCTGTGTC
GGCAGCGGCAAAGGACGGCGACGCTGCGGCGGACGAGGACGACGACGAGGCCGGTGGCGGTGGTCTTATGGCGGTTCTGC
GCAAGAACAAGGAGAAACGCAAGAAGAAGGGCCTCCCGGAAGACTTCCACGGAGAGGAGGTACCGGCAGAGGAGACGCCA
GACCTGGCGGCCAAGGCTCCCGAAGAGGCCGGCATGGACGACGAGTTTGCACTTCCGGAAAAGAAGGGCAAAGGTGGTGC
TTCAGGAAAGAACGGCAAGGGAGCTGCTCCGGCGAAAAAAGAGGAGCCAGCCGACGAGGAGGGCAACGGCGGACGGATGT
TGACCAAGGCGGAGAAGGAGAAGCAAAAGAGGGAGCGGGAAAAGCAGAGAAAGAAAGAGCAGGCTGCGAAGAAAAAGACA
ACGACGCCGGCGCAGGATGAAGCAGCCAAATCTGGACCAGTAGCAGAGAAGCAGGTAAAGGCGGCAGCGCCGGTGGCGGC
GGCAGAAGAGCCTGTCGCGGCAGGTGGAAAGAAGAAGAAGCTCCCGGCACACCTGCTGGCGATCCAGCGGCAGCAAGAAG
AGCTTCGTCGGCAGAAAGAGGAGGAAGAACGGTTTCTGGCGGAGGAAAAGGTACGACTGGAGGAGCTGGAACGGCAGGAG
GCCGAGGAGCTGAAGCGTAAAGAAGAGCAGAGGGCGGCTCGGAAGCAGAAGGAGAAGGAGAGGATCGAGCAACTCAAGAA
GGAGGGCAAGTACCTGACGAAGGCGCAGAAGGAGGCCAAGGCACGCAACGAGCAGAAGCTGCAGCAGATGGTGGCAGCAG
GCGTGGTCAAGGTGGCAGCTCCGGATGCGTCGGGTGAGGAGAAGAAGAAGGCGACAAAGGAGAGCAAGAAGCGTGGTGGT
GGGCGGCGAGAGAAGGTGGACGAGGCAAAGGTGCTGGAGGAGGCAGCAGAGCGAGCACGACTGCAGGCAGAGAAGCTGGC
CAAGGAGGCTGAAGAGCGCGAGCTGGCGAAGCAAAAAGCCGAGGAGGAAGCAGCACGGAAGGCAGCCGAGGCAGCAGGAA
GTGACATTGACGAGGACTGGGAGACGGCAGCGGACGCGAAGCTCAGCCTGGAGGACGTCAAGGACAGCTGGGACGCTGAC
TCGGACGCAGAGAAAGAGGCGAAGAAGGCAGAGAAGAAGGGTTCGAACTCGGACTCGGACTCGGGAAGCGACTCGGGCAG
CGACTCGGACAGCGAGTCAGAGTCGGACGACGAGCTGACATCGGCAGCCAAGGCAGCAGAAGCACAGCGGAAGAAGGAGC
TGGCAGAGATGCGCGAGAAGGAGCACCAAGCAGCACTGGCAGCCCGAAGCAAGGACAACTTGCGGTCACCCATCTGCTGC
ATCATGGGACACGTCGACACGGGCAAGACGAAGCTGCTGGACAAAGTGCGGCAGACCAACGTGCAGGAGGGCGAGGCGGG
CGGGATCACACAGCAGATCGGCGCGACGTACTTCCCGATCGACGCGATCCGACAAAAGACAGCAGTGGTCAACAAGGACG
GGTCGTTTGAGTTCAAGGTGCCGGGACTGCTGATCATCGACACGCCGGGCCACGAGTCGTTCTCGAACCTGCGGTCGCGC
GGATCGTCGCTGTGCAACATTGCGATCCTGGTGGTGGACATCATGCACGGGCTGGAGCAGCAGACGCTGGAGTCGATGCG
GATGCTGCGGGACCGCAAGACGCCCTTTATCGTGGCGCTCAACAAGATTGACCGGCTGTACGGGTGGAAGAAGGTGGACA
ACAACGGATTCGAGGACAGTCTGGCGCTGCAGAACCGTGGCGTGCAGAACGAGTTCAGCAAGCGGCTGGAGCAGACGAAG
CTGGCCTTTGCCGAGCAGGGCTTCAACACGGAGCTCTTTTACGAGAACAAGAACATGTCGCGGATCGTGTCGCTGGTGCC
GACGTCAGCCCACACGGGCGAAGGCGTGCCCGACATGCTGAAGCTGCTGGTGCAGCTGACACAAGAGCGTATGACAGACT
CGCTGATGTACCTGTCCGAGGTGCAGGCGACCGTGCTGGAGGTCAAGGCGATTGAGGGGTTCGGCATGACCATTGACGTG
ATCCTGTCCAACGGCATTTTGCGCGAGGGCGACCGGATCATCCTGTGTGGTGTCGAGGGCGTGATCAAGACGAACATCCG
CGCTCTGCTGACGCCGGCGCCTTTGCGCGAGCTGCGCATCCGCTCGGCCTACGTGCACAACAAGGAGGTGCGTGCAGCCA
TGGGTATCAAGATCAGCGCACCCAATCTCGAGGGTGCCATTGCCGGCTCGCGGCTGCTGGTAGTCGGCAAGTACGACGAC
GAGGAGGATCTGGAAGAAGAGGTCGAGTCCGACCTGGCTTCCGTCTTCAGCCGGGTCGAAAAGTCCGGCCGTGGCGTCAG
CGTCCAGGCCTCCACGCTCGGCTCGCTCGAGGCCCTGCTCGACTTCCTTAAGGACTCCAAGATCCCGGTGGCCAACGTCG
GCATCGGTCCGGTCTTTAAGCGCGACGTGATGCAGTGCAGCACCATGCTGGAGAAGAATCCTGACTACGCCGTCATGCTC
TGCTTCGACGTCAAGGTCGACAAGGAGGCTATGGCCTATGCCGACGACCAGGGCATCAAGATCTTCACCGCCGACATCAT
CTACCACCTCTTTGACGCCTTCACCAAGCATATGCGCGAGCTGAGCGAGAAGAAGAAGGAGGAGTCCAAGATGCTCGCCG
TCTTCCCCTGCGTCCTCTCCACCGTCGCTGTCTTCAACAAGACCGGTCCCATCGTCATCGGCGTCGACGTGCTCGAGGGC
CAGCTCAAGCTCAACACGCCCATCGCCTGCGTCAAGATGAACCCAAACACGAACCAGAAGGAGATTATCAGTCTCGGCCG
AGTGTATGTCACGTGATTCATTGCTTAGTCACTCTAGCTAACCAAAACCCCCCCCCTCCAGGACCTCCATCGAGCGCGAA
CATAAGCAGATCAACGTCTGCAAGCCCGGCCAGCCGTCGGTGGCGGTCAAGATCGAGATGGGCGGCCACCAGCCCACGTA
CGGCCGCCACCTGGAAGAGACCGACCAGCTGTACAGCCTCGTGTCGCGCGCCAGCATCGACTGCCTCAAGGAGTTCTACC
GCTCCGACGTATCGGCCGAGGAGTGGAAGCTACTGATCAAGCTGAAGCCGCTGTTTAACATCCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62