GenePrediction:GLEAN_4119 Details

Name: GLEAN_4119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2914939..2916311 (+ strand)
Length: 1373
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2914939..2914996 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_113:2915067..2915314 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_113:2915491..2915536 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_113:2915604..2915888 (+ strand)
Length: 285
Type: CDS
Source: GLEAN
Position: GCSC_113:2915947..2916311 (+ strand)
Length: 365
>GLEAN_4119 class=GenePrediction position=GCSC_113:2914939..2916311 (+ strand)
ATGGACTACCATACTATCCACGGCCACGATGTCGAGGGGTTTGGCACGCCATTGACACGTGAGCATCCTATATGACTACG
GCATAAAACATGGATTATGGAACGGTTGGCTGATATATATCTGCGAAGACCGAGTCCTGACTGTGTCTGCGGCCGATGTT
GACGCGGCCTTGTTGAGCCCGTCGCCGGCGTCGTCGACAGGGCCCGATCTGACGACACCAGCGCGACTTGTGCCTACCGG
CATCTCCACACTGGATTCTATCTTGTCTGATTCACCAGCTCCACATGCAGGCGCGGGAGACGCAACAGAAGATGGAGACG
AGGCTGAAACGGAGGCGAAGGCGGGAACGACGTCGGATCTAGAGCCACTGTCGATAGTAAGACAGCAAAGCTCACAGAAA
CAGAGAGCAGCAAGGCCACTTCGATCGAGAACAGGTCTCCGTCGGGGACAGCTTACGGAGATATGGGGCCCTCCAGGTGC
AGGAAAGACGGCGTTTGGGTAAGTGGAAAGGAGGCATACGAAGCCGGCCAGCTGACTCTTGACAGAATGCAGCTCGCTGC
AAACGCGTTGTCGGGCGGAAGCAGTGCTGTGTGGGTAGGTGTGTGCACCGTTTCTGGGGGCTCTCCTTGCGTTGCGATCA
GAGCCAGACGGCTAACACGAAGCAGACTGCTTCCACTCCCTGTGTAGAGAACGGCTGACGGCCATTGCCGAAGCTCATAC
GGGGCCCGACAAGGGGGCTAAGAGCGTGGAAGAAGGATTTGTACACTATACGTGTCCCAGTCTTCCGCACTTCATTGCTA
TGTTCTGCCCATCGACGTCGGTGTCTACGGTCGAAATACCTGCAGATGCGTCTGTCGTGGTCATCGACTCTCTCTCCGCT
CTCGTGAACCACGCGCTTCCAAGGACAGTAGAGAAGAAGGGTGCACCGCTCATGGCGAACGGGAAAAGGGGTAGGAATGG
TGTACTTCCCTTTTATGTTGTAATCTGTGCTAATAACGATGACCCCAGGTCCTGCGGCACATGAAAAGAGGACACAGGTG
CTGCAGTACATTGTCGCGGCACTCGAACGACTAGCAGAGACACAGAATGTCGCCGTCATCCTGCTTACGCAATGTGCCAG
TCGCGTACAGGCAGACGGTGGTGGAGCCGCCTTGGTGCCAGCCATTAACGCGGCAGTTTGGGACCGCGGTATCGCCACGC
GTATCGTTCTGTTCCGGGACTGGGCCTGGAAGGACGGCGAGGCCGTCGGCGGTCGCTTTGCCGGCATACAGAAGCTCAAT
CGCAGTGGCGGCGATACCGCGCTGAGCCACGTCGTTGCGTTTTCCATCGCGGAGGCAAGTCTTCTCTCCACTAATCTGCG
AATTCTGTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62