GenePrediction:GLEAN_411 Details

Name: GLEAN_411
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1621125..1621611 (+ strand)
Length: 487
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1621125..1621189 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_167:1621251..1621611 (+ strand)
Length: 361
>GLEAN_411 class=GenePrediction position=GCSC_167:1621125..1621611 (+ strand)
ATGCCCAACATGTCCTGGTTTTCAGCCCTGACGACGGCCTTTGGCTCTATCCTGCTGGCACATGCGTATGCGCTTCTTTC
TGCTCTCGAACCCATTGCTACAGACTGACTCTTGCTTCCTCCATAGATGCTACTCGGCGCAGGAGTTTTCTACCTTCCAG
TCCCTTCGCTCTTCAGCAGGTGCGGCTTCATCGCCGTCGGACTCTCTTCCCATTGACATTACCATCGAAACCATTGCCGC
ATTACTCGTCATCAGCCTGGGCCTCGTCCTGGGAACGAACGATCTCCGCCCGATCCACTGGCATGTGTGGGCCGGCAAGA
TTGAGCGTGAGGGTGAAGAAGGAGCCAAGAATGCTGAGGGCGAGGTGAGCAAGGACTTTATGGGGAACCCGTTCAGCTAC
CTGGAGACACGGCCAAGTTTCGTCGACGTCCGCCGGCAGAGAAAGGAGTTTGAAGAATGGGTGCGGACGGGTGGCGAGTC
GAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62