GenePrediction:GLEAN_4120 Details

Name: GLEAN_4120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2920274..2921295 (+ strand)
Length: 1022
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2920274..2920559 (+ strand)
Length: 286
Type: CDS
Source: GLEAN
Position: GCSC_113:2920658..2921295 (+ strand)
Length: 638
>GLEAN_4120 class=GenePrediction position=GCSC_113:2920274..2921295 (+ strand)
ATGCTGTTCAAGTCATCCACCACCGTGGCCATCCTGGCTGTCGCCTCGCAAGTTGTGGCTGAGCCGGCCGCTTACAAGGC
CGTCAAGGTCATGTCCATCCGCGACATGTTCGGCGTCGTCCGTCGCGACAACGGCGGCTACACACCGACAGAGTCCACCT
GTGGCATGGGCGATACCTGTGCTCAGGCTTGCGGTGCTGGCTTCGAGACCTGTGCCTCGTCCGACAACGCTATTCACTGC
TACAACCCGGCGGCCAGCCAGATCTGCTGTCCCGATAACAGTGGCAGTACGTATTTTTTATGTTTTATGCTCATTTTGTG
ACGCATTATCTGTTGCTACAGAGCCTCTCCGTTTTCACCATCTTGCTGACATCCTGCTCGCTAGACTCGTGTGATTCTGG
CTACTATTGTACTGCTGCCACCAACAGCGATACCATCTGCTGTCCTGAGGGTCAGACCCTGGAGCAGTGTGCTATCGCTT
ACGGCGTGACCGGCAGTCTGGTCTCTGAGACTGCCACGCCTACCCCCACGCCCAGCTCCTCGTCCCTGTCGTCGTCCTCG
TCGTCGGTGATCTCGTCGACGCTCACGTCGTCGTCGTCCTTCTCCTCATCCTCGTCTTCGTCATCTTCGTCGTCTTCGTC
TACCTTTTCCTCCTCGTCTACCCTCTCGTCGTCCCTTGTGACCAGCTCGTCTATCGCGCCGTTCTCGTCAGCAGCCCCCA
ACATCACCTCGTTCAGCAGCATCATCGCCTCATCGTCGACCTCCGTCTCGGCGGCGCCGCTCGTGTTCGCCAACGGCACC
ACCGTCTCCGTCAAGGCTACTGGCTACGCCACGACGTCGTGCTCAGCTACATCCCAGTATGCTGCCACCGCTGCCGCCTA
TGCTACTAGCAACTTTACCTCGGCCCAGGTGTCTGCAGCGGCTGCCGAGACTACGGCGCCTGTCGTCAGCGGTGCTGGTG
TGATCCGGCCTGTTGCTGCCGTTGTCGCTCTGGTGGCCGCTGCCTTCGCCGTGGCGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62