GenePrediction:GLEAN_4121 Details

Name: GLEAN_4121
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2923954..2925383 (+ strand)
Length: 1430
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2923954..2924045 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_113:2924108..2925000 (+ strand)
Length: 893
Type: CDS
Source: GLEAN
Position: GCSC_113:2925070..2925383 (+ strand)
Length: 314
>GLEAN_4121 class=GenePrediction position=GCSC_113:2923954..2925383 (+ strand)
ATGGGGGGCAGCATCTCTCCTGAGGGCGTAGATACACCCCCTTCCGGCACCGGCACCAACACTGTCGTCGCTGCGGATGA
GTTTTCATGGCTGTATGTATCGAACCCAGACATCTACAGGCCTTTCTACACATGCACTGACCCAAACGTCCCAGAGATCC
CCATCCCATCTTTGTGATCATCCTGGTAGGCCCTGATGAGAGGCCTTTTGGTATTCAGAAAGACTTCTTGTGCTCAAAAT
GCCACCACTTTCGTAATCACTTCGCCAAGAATGCTGAGGATGCTATCGAACACGTCGTTCGATTACCAGAGACGCCCGTT
CAAGTCTTCGCTCATGCCCAGCACTTTCTTTATACGGGAAATGTCTTTGTCAGTACCGATCAGATGCCGTCTTACGACGT
GCTCGTCAACATCTGGAAGCTTGGCCATAGCTTAGGCATCGACGGTCTCTGCGAGCGCACCCTTGAGGCGATGGCTGAGT
ACAAACGTGCCACCCACTGCATCCCGGATACACCGCTACTGGTCCAGGTGTGGAAGGACACACCCGCTGGCTCATCTATC
CGTCAACTGCTGCTCTCTTGGGCAGCCGAATATCTTCGGTCCAGTCATGAGCGCTCCGAGTTCGCCCGTTCACTGCCACA
AGAACTACTCAGCGAACTGGTCGTTGCTATGAGCTCATATGGTGACGGCGTCCTAGCCGCGCCTGGACCAGGAACCGGAG
CTGCAAGCGATGTCGGCCCCAAGAAGAACGTACATTATATGAACGGCGGTGACGATTTTGCGGCTGCAGACTACAGCAGC
GGAAGTGGAGACCGGGACCTGTCGCCTGCTTCGAAGCGGGCACGCCATACTGAGTATCCGTCAAAAACCGCTGCTTCCTC
TGCGGCAACTAATTTGGCAGGTCCTGGAAAGGCTGGCAGAACCTCACTCCCAAACCACCGGATGCCACCCAAGAAGCGCA
ACAGCATGGCGGGTACGGAGACATTTACCGCAGACCAGAAGCTCAAGTTCTGTTCTGATTTGATCAACCGGATGCTCTCA
GGACCAGGTATGTGAACATATACTGGAACTGTTTTTGCCGCTGCCGAGAGCCTACAACTGACATGTTCGAAATTAGGGTT
CTGGACGCGCCTGGTTGGTCCCTTCAGAGACGCCGTGGACCCCGTAACTGAAGGAATTCCCGACTATTTGGATAAGATCA
AGCGGCCGATGGACCTAAGCACAATCAAGTCCAATCTAGATCGAGGCTTATACCGATCTGAAGACGAGTTCTTGACAGAC
ATGCAACAAATATTCTCCAATGTTTACACATACTGGAAGAGGGATGACCCTATATGGGTTGTGTGTAAGCGGCTGCAAAG
GACGTTCGAGGAGAAGTACGCACAGATGAACAAGTGGTTAGGTAAGATGGACGGTGAGGTGCCCCCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62